Gene Rv2495c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Involved in energy metabolism. The branched-chain alpha-keto acid dehydrogenase complex catalyzes the overall conversion of branched chain alpha-keto acids to acyl-CoA and CO2. It contains multiple copies of three enzymatic components: branched-chain alpha-keto acid decarboxylase (E1), lipoamide acyltransferase (E2) and lipoamide dehydrogenase (E3). |
Product | Probable branched-chain keto acid dehydrogenase E2 component BkdC |
Comments | Rv2495c, (MTCY07A7.01c-MTV008.51c), len: 393 aa. Probable bkdC, branched-chain keto acid dehydrogenase, E2 component, similar to others e.g. Q9XA49|SCGD3.30c from Streptomyces coelicolor (491 aa) FASTA scores: opt: 615, E(): 1.2e-28, (36.45% identity in 491 aa overlap; several gaps); P19262|ODO2_YEAST|KGD2|YDR148C|YD8358.05c from Saccharomyces cerevisiae (Baker's yeast) (463 aa) FASTA scores: opt: 533, E(): 7.1e-24, (28.55% identity in 396 aa overlap); Q9HN75|DSA|VNG2219G from Halobacterium sp. strain NRC-1 (478 aa), FASTA scores: opt: 521, E(): E(): 3.7e-23, (30.25% identity in 486 aa overlap; in part); etc. Belongs to the 2-oxoacid dehydrogenase family. Alternative nucleotide at position 2809621 (T->C; T107A) has been observed. LpdC|Rv0462 co-immunoprecipitates with DlaT|Rv2215 (in lpdC|Rv0462 mutant) and with BkdC|Rv2495c (in dlaT|Rv2215 mutant) (See Venugopal et al., 2011). Previously known as pdhC. |
Functional category | Intermediary metabolism and respiration |
Proteomics | Identified in the cell membrane fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified by mass spectrometry in whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011). |
Transcriptomics | mRNA identified by microarray analysis and up-regulated after 24h and 96h of starvation (see citation below). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). M. tuberculosis H37Rv dlaT|Rv2215 mutant shows increased growth in 7H9 with leucine or isoleucine while lpdC|Rv0462 mutant and bkdC|Rv2495c-dlaT|Rv2215 double mutant show little or no growth; growth of M. tuberculosis H37Rv bkdC|Rv2495c mutant is comparable to wild-type, in vitro and in C57BL/6 mouse lungs; growth of bkdC|Rv2495c-dlaT|Rv2215 double mutant in C57BL/6 lungs is strongly attenuated (See Venugopal et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 2808758 | 2809939 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2495c|2808758-2809939|-|bkdC|downstream:0|upstream:0 atgagcggtgaggacagcatcaggtctttcccggtgcccgacctcggcgagggactgcaggaagtgacggtgacgtgttggagcgtcgccgtcggcgacgatgtggagatcaaccagacgctgtgttcggtggagaccgccaaggccgaggtcgaaatccccagcccgtatgccggccggatcgtcgagttaggcggcgccgaaggcgatgtgctcaaagtgggcgcggagctagttcggatcgacaccgggcccacggcagttgcgcagcctaacggtgaaggagcggtccccacgttggtcggctacggtgccgacaccgcgatcgaaaccagtagacggacaagccggccgctggcggcaccggtagtgcgcaagctggccaaagagttggcggtcgacctggccgcattgcagcgtgggtcgggcgccggcggtgtgatcacccgggccgatgtgctggccgctgctcgaggcggcgtcggagccgggccggacgtgcggccggtccacggcgtgcacgcgcggatggccgaaaaaatgacgttgtcccacaaggagattccgaccgcaaaggccagcgttgaggtaatttgcgccgaactgctgcggctgcgcgaccggttcgtttcggcggcgcccgagattacaccgttcgcgctgacgctgcggctgctggttattgcattgaaacacaacgtaattctcaactcgacgtgggtcgactcgggcgaaggcccgcaagtacacgtgcatcgcggtgtgcatctggggttcggcgcggccactgagcgtggattgctggtgccggtggtgaccgacgcccaggacaagaacacccgcgaacttgcctcccgcgtagcggaattaatcaccggcgcacgtgaaggcactctcacacccgcggagctgcgcggttcgacgttcacggtgtcgaacttcggggcgctgggagtcgacgacggcgtgccggtgatcaaccatcccgaagcggcgatcctgggtctgggggcgatcaagccgcgcccggtggtcgtcggcggcgaggttgtcgcacggccgacgatgacgttgacttgtgtgttcgaccaccgcgttgtcgatggtgctcaggtggcccagttcatgtgtgagctgcgggatctgatcgagtcgccggagaccgcgctgttggatctgtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2495c|bkdC MSGEDSIRSFPVPDLGEGLQEVTVTCWSVAVGDDVEINQTLCSVETAKAEVEIPSPYAGRIVELGGAEGDVLKVGAELVRIDTGPTAVAQPNGEGAVPTLVGYGADTAIETSRRTSRPLAAPVVRKLAKELAVDLAALQRGSGAGGVITRADVLAAARGGVGAGPDVRPVHGVHARMAEKMTLSHKEIPTAKASVEVICAELLRLRDRFVSAAPEITPFALTLRLLVIALKHNVILNSTWVDSGEGPQVHVHRGVHLGFGAATERGLLVPVVTDAQDKNTRELASRVAELITGAREGTLTPAELRGSTFTVSNFGALGVDDGVPVINHPEAAILGLGAIKPRPVVVGGEVVARPTMTLTCVFDHRVVDGAQVAQFMCELRDLIESPETALLDL
Bibliography
- Betts JC et al. [2002]. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Transcriptome
- Tian J, Bryk R, Shi S, Erdjument-Bromage H, Tempst P and Nathan C [2005]. Mycobacterium tuberculosis appears to lack alpha-ketoglutarate dehydrogenase and encodes pyruvate dehydrogenase in widely separated genes. Function
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Venugopal A et al. [2011]. Virulence of Mycobacterium tuberculosis depends on lipoamide dehydrogenase, a member of three multienzyme complexes. Mutant Operon Product
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant