Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionWide specificity for D-amino acids. Also acts on glycine [catalytic activity: a D-amino acid + H2O + O2 = a 2-oxo acid + NH3 + H2O2]
ProductProbable D-amino acid oxidase Aao
CommentsRv1905c, (MTCY180.13), len: 320 aa. Probable aao, D-amino acid oxidase, similar to many. Equivalent to AJ000521|MLCOSL672.02|O33145 Mycobacterium leprae (320 aa), FASTA results: opt: 1541, E(): 0, (71.7% identity in 315 aa overlap); also similar to OXDD_BOVIN|P31228 d-aspartate oxidase from bos taurus (338 aa), FASTA results: opt: 461, E(): 1.1e-21, (31.8% identity in 321 aa overlap).
Functional categoryIntermediary metabolism and respiration
ProteomicsIdentified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv and CDC1551 strains (see Sassetti et al., 2003 and Lamichhane et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS21514332152395-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv1905c|2151433-2152395|-|aao|downstream:0|upstream:0
gtggcaataggtgagcaacaggtcatcgtgattggggccggcgtcagcggactgacgtcggccatatgcctggccgaggcggggtggccggtgcgggtatgggcggccgcattgccgcagcaaacgacatcggcggtggcgggtgcggtctgggggccgcggccgaaggaacccgttgccaaggtacgcgggtggatcgaacagtcattgcacgtgtttcgcgacttggccaaggatcccgccaccggcgtgcgcatgacgccggcgctgagtgtcggcgatcgtatcgagaccggtgcgatgccgcccgggttggagctgatccccgacgtgcggccggctgacccggccgacgtgcccgggggcttccgtgctgggtttcatgccaccttgccgatgatcgatatgccccagtacctcgactgtctgacccagcgattggcggcgactggctgtgaaatcgaaacgcgcccgctacggtcgctggccgaggccgctgaggcggcgcccatagtgatcaactgtgctggtctgggcgctcgggaactggccggcgacgccacggtctggccgcggttcggccagcacgtcgtcctcaccaatccaggtctagagcaactgtttatcgagcgcaccggcggctcggaatggatctgctactttgcccacccgcagcgtgtagtctgcggcggcatcagtatccctggcaggtgggaccccaccccagagccggagataaccgagcggatcctgcaacggtgtcgccgcatacaaccacggcttgccgaggcggcagtgattgagacgattaccgggctgcgtcctgatcggccgtccgtgcgggtggaagctgaaccgatcgggcgagcgctgtgcatccacaactatggccacggaggtgacggcgtgaccctgtcatggggttgtgcgcgggaggtggtcaatcttgtcggcggcggttaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv1905c|aao
VAIGEQQVIVIGAGVSGLTSAICLAEAGWPVRVWAAALPQQTTSAVAGAVWGPRPKEPVAKVRGWIEQSLHVFRDLAKDPATGVRMTPALSVGDRIETGAMPPGLELIPDVRPADPADVPGGFRAGFHATLPMIDMPQYLDCLTQRLAATGCEIETRPLRSLAEAAEAAPIVINCAGLGARELAGDATVWPRFGQHVVLTNPGLEQLFIERTGGSEWICYFAHPQRVVCGGISIPGRWDPTPEPEITERILQRCRRIQPRLAEAAVIETITGLRPDRPSVRVEAEPIGRALCIHNYGHGGDGVTLSWGCAREVVNLVGGG