Gene Rv0946c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Involved in glycolysis and in gluconeogenesis [catalytic activity: D-glucose 6-phosphate = D-fructose 6-phosphate]. |
Product | Probable glucose-6-phosphate isomerase Pgi (GPI) (phosphoglucose isomerase) (phosphohexose isomerase) (phi) |
Comments | Rv0946c, (MTCY10D7.28), len: 553 aa. Probable pgi, glucose-6-phosphate isomerase, equivalent to NP_301236.1|NC_002677 glucose-6-phosphate isomerase from Mycobacterium leprae (554 aa); and P96803|G6PI_MYCSM glucose-6-phosphate isomerase from Mycobacterium smegmatis (442 aa). Also highly similar to others e.g. T36015 glucose-6-phosphate isomerase from Streptomyces coelicolor (551 aa); P11537|G6PI_ECOLI|GPI glucose-6-phosphate isomerase from Escherichia coli strains K12 and O157:H7 (549 aa), FASTA scores: opt: 1779, E(): 0, (51.4% identity in 554 aa overlap); etc. Contains PS00765 Phosphoglucose isomerase signature 1, and PS00174 Phosphoglucose isomerase signature 2. Belongs to the GPI family. |
Functional category | Intermediary metabolism and respiration |
Proteomics | Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the membrane fraction of M. tuberculosis H37Rv using nanoLC-MS/MS (See Xiong et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the culture filtrate, membrane protein fraction, and whole cell lysates of M. tuberculosis H37Rv (See de Souza et al., 2011). Translational start site supported by proteomics data (See de Souza et al., 2011) (See Kelkar et al., 2011). |
Mutant | Essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene results in growth defect of H37Rv in vitro, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 1055024 | 1056685 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0946c|1055024-1056685|-|pgi|downstream:0|upstream:0 atgacctccgcgccaatccccgacatcaccgctaccccggcatgggacgccctgcgcagacatcacgatcagatcggaaacacccatcttcgccagttcttcgccgacgatccgggtcgcggccgggagctcaccgtcagcgtcggcgatctctacatcgactacagcaaacaccgcgtcacccgcgagacgctggcgctgctgatcgatctggcccggacggcccacctcgaagagcgtcgcgaccagatgttcgccggtgtgcatatcaacacctctgaggatcgagcggtgttgcacaccgcgctgcggctgccccgagacgccgaactcgtcgtcgacggccaagacgtcgtcaccgacgtacatgccgtgctcgacgcgatgggcgccttcaccgaccgcctgcgcagcggcgagtggaccggagcaactggaaagcggatcagcaccgtcgtcaacatcggcatcggtggttcggatttgggtccggtgatggtgtaccaagcgttgcgccactatgccgacgcgggcatttccgcgcgcttcgtgtccaacgtcgatcccgccgacctgatcgccacgctcgccgatctagaccccgccacaacgcttttcatcgtcgcgtcgaagacgttctcgacgctggagacattgaccaatgcgaccgcggcgcgtcgctggctgaccgatgcgctgggcgacgccgcggtgtcgcggcattttgtcgcggtgtccaccaacaagcgcctggtcgacgacttcggcatcaacaccgacaacatgttcggtttttgggattgggtcggcgggcgttattcggtggattcggcgatcgggctgtcgttgatgacggtgatcggccgcgacgccttcgccgatttcttggccggattccacatcatcgaccgccatttcgcgaccgctccgctggaatccaacgcgccggtgctgcttggcctgatcggactgtggtactccaatttcttcggtgcgcaatcacgcaccgtgctgccgtattccaatgacttgtcgcgttttccggcctaccttcagcagttgaccatggaatccaacggcaagtccacgcgcgccgacggcagcccggtcagcgccgacaccggtgaaatcttttggggtgaaccgggaaccaacggccagcacgccttctaccagttgctgcaccagggcacccggctggtgccagccgatttcatcggctttgctcaacccctcgacgacctgccgaccgccgagggcaccggcagcatgcatgatctgctgatgagcaacttcttcgcccaaacccaggtgctggcgttcggcaagaccgccgaggagatcgccgccgacggcacccccgcccacgtggtagcgcataaggtgatgcccggcaaccggccgtccacctcaattctggccagtcggctcacgccgtcggtgctggggcagttgatcgcgctctacgagcatcaggtgttcaccgagggtgtggtgtggggtatcgactcgttcgaccagtggggggtggagctgggcaagacgcaggccaaggcgctgcttccggtaatcaccggcgccggttcaccgccaccgcagtcggacagctcgaccgacgggctggtgcgccgctaccgcaccgaacgtggccgcgcgggctag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0946c|pgi MTSAPIPDITATPAWDALRRHHDQIGNTHLRQFFADDPGRGRELTVSVGDLYIDYSKHRVTRETLALLIDLARTAHLEERRDQMFAGVHINTSEDRAVLHTALRLPRDAELVVDGQDVVTDVHAVLDAMGAFTDRLRSGEWTGATGKRISTVVNIGIGGSDLGPVMVYQALRHYADAGISARFVSNVDPADLIATLADLDPATTLFIVASKTFSTLETLTNATAARRWLTDALGDAAVSRHFVAVSTNKRLVDDFGINTDNMFGFWDWVGGRYSVDSAIGLSLMTVIGRDAFADFLAGFHIIDRHFATAPLESNAPVLLGLIGLWYSNFFGAQSRTVLPYSNDLSRFPAYLQQLTMESNGKSTRADGSPVSADTGEIFWGEPGTNGQHAFYQLLHQGTRLVPADFIGFAQPLDDLPTAEGTGSMHDLLMSNFFAQTQVLAFGKTAEEIAADGTPAHVVAHKVMPGNRPSTSILASRLTPSVLGQLIALYEHQVFTEGVVWGIDSFDQWGVELGKTQAKALLPVITGAGSPPPQSDSSTDGLVRRYRTERGRAG
Bibliography
- Gu S et al. [2003]. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Proteomics
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Xiong Y, Chalmers MJ, Gao FP, Cross TA and Marshall AG [2005]. Identification of Mycobacterium tuberculosis H37Rv integral membrane proteins by one-dimensional gel electrophoresis and liquid chromatography electrospray ionization tandem mass spectrometry. Proteomics
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Kelkar DS et al. [2011]. Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry. Proteomics Sequence
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- de Souza GA et al. [2011]. Proteogenomic analysis of polymorphisms and gene annotation divergences in prokaryotes using a clustered mass spectrometry-friendly database. Proteomics Sequence
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant