Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionInvolved in glycolysis and in gluconeogenesis [catalytic activity: D-glucose 6-phosphate = D-fructose 6-phosphate].
ProductProbable glucose-6-phosphate isomerase Pgi (GPI) (phosphoglucose isomerase) (phosphohexose isomerase) (phi)
CommentsRv0946c, (MTCY10D7.28), len: 553 aa. Probable pgi, glucose-6-phosphate isomerase, equivalent to NP_301236.1|NC_002677 glucose-6-phosphate isomerase from Mycobacterium leprae (554 aa); and P96803|G6PI_MYCSM glucose-6-phosphate isomerase from Mycobacterium smegmatis (442 aa). Also highly similar to others e.g. T36015 glucose-6-phosphate isomerase from Streptomyces coelicolor (551 aa); P11537|G6PI_ECOLI|GPI glucose-6-phosphate isomerase from Escherichia coli strains K12 and O157:H7 (549 aa), FASTA scores: opt: 1779, E(): 0, (51.4% identity in 554 aa overlap); etc. Contains PS00765 Phosphoglucose isomerase signature 1, and PS00174 Phosphoglucose isomerase signature 2. Belongs to the GPI family.
Functional categoryIntermediary metabolism and respiration
ProteomicsIdentified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the membrane fraction of M. tuberculosis H37Rv using nanoLC-MS/MS (See Xiong et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the culture filtrate, membrane protein fraction, and whole cell lysates of M. tuberculosis H37Rv (See de Souza et al., 2011). Translational start site supported by proteomics data (See de Souza et al., 2011) (See Kelkar et al., 2011).
MutantEssential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene results in growth defect of H37Rv in vitro, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS10550241056685-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0946c|1055024-1056685|-|pgi|downstream:0|upstream:0
atgacctccgcgccaatccccgacatcaccgctaccccggcatgggacgccctgcgcagacatcacgatcagatcggaaacacccatcttcgccagttcttcgccgacgatccgggtcgcggccgggagctcaccgtcagcgtcggcgatctctacatcgactacagcaaacaccgcgtcacccgcgagacgctggcgctgctgatcgatctggcccggacggcccacctcgaagagcgtcgcgaccagatgttcgccggtgtgcatatcaacacctctgaggatcgagcggtgttgcacaccgcgctgcggctgccccgagacgccgaactcgtcgtcgacggccaagacgtcgtcaccgacgtacatgccgtgctcgacgcgatgggcgccttcaccgaccgcctgcgcagcggcgagtggaccggagcaactggaaagcggatcagcaccgtcgtcaacatcggcatcggtggttcggatttgggtccggtgatggtgtaccaagcgttgcgccactatgccgacgcgggcatttccgcgcgcttcgtgtccaacgtcgatcccgccgacctgatcgccacgctcgccgatctagaccccgccacaacgcttttcatcgtcgcgtcgaagacgttctcgacgctggagacattgaccaatgcgaccgcggcgcgtcgctggctgaccgatgcgctgggcgacgccgcggtgtcgcggcattttgtcgcggtgtccaccaacaagcgcctggtcgacgacttcggcatcaacaccgacaacatgttcggtttttgggattgggtcggcgggcgttattcggtggattcggcgatcgggctgtcgttgatgacggtgatcggccgcgacgccttcgccgatttcttggccggattccacatcatcgaccgccatttcgcgaccgctccgctggaatccaacgcgccggtgctgcttggcctgatcggactgtggtactccaatttcttcggtgcgcaatcacgcaccgtgctgccgtattccaatgacttgtcgcgttttccggcctaccttcagcagttgaccatggaatccaacggcaagtccacgcgcgccgacggcagcccggtcagcgccgacaccggtgaaatcttttggggtgaaccgggaaccaacggccagcacgccttctaccagttgctgcaccagggcacccggctggtgccagccgatttcatcggctttgctcaacccctcgacgacctgccgaccgccgagggcaccggcagcatgcatgatctgctgatgagcaacttcttcgcccaaacccaggtgctggcgttcggcaagaccgccgaggagatcgccgccgacggcacccccgcccacgtggtagcgcataaggtgatgcccggcaaccggccgtccacctcaattctggccagtcggctcacgccgtcggtgctggggcagttgatcgcgctctacgagcatcaggtgttcaccgagggtgtggtgtggggtatcgactcgttcgaccagtggggggtggagctgggcaagacgcaggccaaggcgctgcttccggtaatcaccggcgccggttcaccgccaccgcagtcggacagctcgaccgacgggctggtgcgccgctaccgcaccgaacgtggccgcgcgggctag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0946c|pgi
MTSAPIPDITATPAWDALRRHHDQIGNTHLRQFFADDPGRGRELTVSVGDLYIDYSKHRVTRETLALLIDLARTAHLEERRDQMFAGVHINTSEDRAVLHTALRLPRDAELVVDGQDVVTDVHAVLDAMGAFTDRLRSGEWTGATGKRISTVVNIGIGGSDLGPVMVYQALRHYADAGISARFVSNVDPADLIATLADLDPATTLFIVASKTFSTLETLTNATAARRWLTDALGDAAVSRHFVAVSTNKRLVDDFGINTDNMFGFWDWVGGRYSVDSAIGLSLMTVIGRDAFADFLAGFHIIDRHFATAPLESNAPVLLGLIGLWYSNFFGAQSRTVLPYSNDLSRFPAYLQQLTMESNGKSTRADGSPVSADTGEIFWGEPGTNGQHAFYQLLHQGTRLVPADFIGFAQPLDDLPTAEGTGSMHDLLMSNFFAQTQVLAFGKTAEEIAADGTPAHVVAHKVMPGNRPSTSILASRLTPSVLGQLIALYEHQVFTEGVVWGIDSFDQWGVELGKTQAKALLPVITGAGSPPPQSDSSTDGLVRRYRTERGRAG
      
Bibliography