Gene Rv0147
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown; probably involved in cellular metabolism [catalytic activity: an aldehyde + NAD+ + H2O = an acid + NADH]. |
Product | Probable aldehyde dehydrogenase (NAD+) dependent |
Comments | Rv0147, (MTCI5.21), len: 506 aa. Probable aldehyde dehydrogenase (NAD+) dependent, similar to others e.g. DHAP_RAT|P11883 aldehyde dehydrogenase (dimeric NADP-preferring) (452 aa), FASTA scores: opt: 1291, E(): 0, (43.9% identity in 453 aa overlap). Also similar to several Mycobacterium tuberculosis aldehyde dehydrogenases e.g. Rv0768, Rv2858c, etc. Contains PS00687 aldehyde dehydrogenases glutamic acid active site, and PS00070 aldehyde dehydrogenases cysteine active site. Belongs to the aldehyde dehydrogenases family. |
Functional category | Intermediary metabolism and respiration |
Proteomics | Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the cell wall and cell membrane fractions of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified in the membrane fraction of M. tuberculosis H37Rv using nanoLC-MS/MS (See Xiong et al., 2005). Identified in the detergent phase of Triton X-114 extracts of M. tuberculosis H37Rv membranes using 1-DGE and MALDI-TOF-MS (See Sinha et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene provides a growth advantage for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Found to be deleted (partially or completely) in one or more clinical isolates (See Tsolaki et al., 2004). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 173238 | 174758 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0147|173238-174758|+|Rv0147|downstream:0|upstream:0 atgagtgaccgcgtcaaggcggtcgcgccgccggacggaaggacgatgatgaccaccgaatcggttgcccggaagacccagaaatctgagaccgaggctccgcgcgaaccggcgcccgtttcggatgaaaagcaaaccgatgtcgctaaaacggtggctcggctgcgaaagacctttgccagcgggcgtacccgcagcgtcgagtggcgcaagcagcagttgcgcgcgctacagaagttgatggacgagaacgaggacgcgatcgccgcggcactcgccgaggatctggatcgcaatccgttcgaggcatacctcgctgacatcgcgacgacctccgccgaagcgaaatacgcggccaagcgggtgcgcaggtggatgcggcgccgctacctgctgctcgaggtgccgcagctgcccggccgcggctgggtggagtacgagccatatggcaccgtgctaatcatcggtgcctggaactacccgttctacctgaccctgggtccggcggtcggagccattgccgctggaaacgccgtcgtgctcaaaccgtcggaaatcgccgctgcatcggcgcacttgatgaccgaattggtgtatcgctatctcgacaccgaagcgatcgcggtcgtgcagggcgatggtgcggtgagtcaggagctgatcgctcagggtttcgaccgcgtgatgttcaccggtggcaccgagatcggccgcaaggtctacgaaggcgccgcgccgcacctgaccccggtcaccctcgagctcggcggcaagagcccggtgatcgtcgcggccgatgccgatgtagatgtcgcggccaagcggatcgcctggatcaaactgctcaacgccgggcagacatgcgttgcacccgactatgtgctggcggatgccaccgtccgcgacgagctggtcagcaagatcaccgcggccctcaccaagttccgctccggtgcgccgcagggcatgcgcatcgtcaaccagcgtcaattcgaccggctgagtggatacctcgccgcagcgaaaaccgacgctgcagccgacggcggcggggtcgtcgtgggcggcgactgtgacgcatcgaacctgcgcatccaacccaccgtggtcgtcgatcccgacccggacgggccgttgatgagcaacgagatcttcggaccgatcctgccggtggtcaccgtcaaatctctggacgacgcgattcgcttcgtgaactcgcggcccaagccgctatcggcgtacctgttcactaagtcgcgtgcggttcgcgagcgggtgatcagggaggtgccggcgggcggaatgatggttaaccatttggcttttcaggtgtcgacggccaaactgccgttcggtggtgtcggcgcatcgggcatgggtgcctaccacggccgttggggtttcgaggagttcagccaccgtaagtcggtgttgaccaaaccaacccgacccgacctgtccagctttatctacccgccgtacaccgagcgcgccatcaaggtggctcgccggctgttctga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0147|Rv0147 MSDRVKAVAPPDGRTMMTTESVARKTQKSETEAPREPAPVSDEKQTDVAKTVARLRKTFASGRTRSVEWRKQQLRALQKLMDENEDAIAAALAEDLDRNPFEAYLADIATTSAEAKYAAKRVRRWMRRRYLLLEVPQLPGRGWVEYEPYGTVLIIGAWNYPFYLTLGPAVGAIAAGNAVVLKPSEIAAASAHLMTELVYRYLDTEAIAVVQGDGAVSQELIAQGFDRVMFTGGTEIGRKVYEGAAPHLTPVTLELGGKSPVIVAADADVDVAAKRIAWIKLLNAGQTCVAPDYVLADATVRDELVSKITAALTKFRSGAPQGMRIVNQRQFDRLSGYLAAAKTDAAADGGGVVVGGDCDASNLRIQPTVVVDPDPDGPLMSNEIFGPILPVVTVKSLDDAIRFVNSRPKPLSAYLFTKSRAVRERVIREVPAGGMMVNHLAFQVSTAKLPFGGVGASGMGAYHGRWGFEEFSHRKSVLTKPTRPDLSSFIYPPYTERAIKVARRLF
Bibliography
- Gu S et al. [2003]. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Proteomics
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Tsolaki AG, Hirsh AE, DeRiemer K, Enciso JA, Wong MZ, Hannan M, Goguet de la Salmoniere YO, Aman K, Kato-Maeda M and Small PM [2004]. Functional and evolutionary genomics of Mycobacterium tuberculosis: insights from genomic deletions in 100 strains. Mutant
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Sinha S, Kosalai K, Arora S, Namane A, Sharma P, Gaikwad AN, Brodin P and Cole ST [2005]. Immunogenic membrane-associated proteins of Mycobacterium tuberculosis revealed by proteomics. Proteomics
- Xiong Y, Chalmers MJ, Gao FP, Cross TA and Marshall AG [2005]. Identification of Mycobacterium tuberculosis H37Rv integral membrane proteins by one-dimensional gel electrophoresis and liquid chromatography electrospray ionization tandem mass spectrometry. Proteomics
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant