Sequence ID | >CHL090100270 |
Genome ID | AF041468 |
Search identical group | |
Phylum/Class | Cryptophyta |
Species | Guillardia theta |
Start position on genome | 3316 |
End posion on genome | 3388 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gactaagata |
tRNA gene sequence |
GCCGGGATAGCTCAGTTGGTAGAGCAGTGGATTGAAAATCCACGTGTCACCAGTTCAAAC |
Downstream region at tRNA end position |
taacttgaaa |
Secondary structure (Cloverleaf model) | >CHL090100270 Phe GAA a Attg taacttgaaa G - C C - G C - G G + T G - C G - C A - T C A T T G G T C A T G A A | | | | | A T C T C G A C C A G C G | | | | T T G G A G C T A A GTGTC G - C T - A G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |