Symbol:
Mgst1
Name:
microsomal glutathione S-transferase 1
RGD ID:
70927
Description:
Enables glutathione binding activity; glutathione transferase activity; and identical protein binding activity. Involved in Leydig cell differentiation; response to lipopolysaccharide; and response to xenobiotic stimulus. Located in apical part of cell; bounding membrane of organelle; and endoplasmic reticulum. Is active in endoplasmic reticulum membrane and mitochondrion. Orthologous to human MGST1 (microsomal glutathione S-transferase 1); PARTICIPATES IN glutathione metabolic pathway; phase I biotransformation pathway via cytochrome P450; INTERACTS WITH (+)-schisandrin B; (-)-epigallocatechin 3-gallate; (S)-amphetamine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
MGC72699; microsomal GST-1; microsomal GST-I
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
MGST1 (microsomal glutathione S-transferase 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Mgst1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Mgst1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
MGST1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
MGST1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Mgst1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
MGST1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
MGST1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Mgst1 (microsomal glutathione S-transferase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
C2orf78 (chromosome 2 open reading frame 78) HGNC
OMA
Alliance orthologs 3
Mus musculus (house mouse):
Mgst1 (microsomal glutathione S-transferase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
MGST1 (microsomal glutathione S-transferase 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
mgst1.1 (microsomal glutathione S-transferase 1.1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
mgst1.2 (microsomal glutathione S-transferase 1.2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
CG33177
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
CG33178
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Mgstl
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
mgst1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
mgst1
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 172,760,930 - 172,776,157 (+) NCBI GRCr8 GRCr8 Ensembl 4 172,760,886 - 172,776,875 (+) Ensembl GRCr8 Ensembl mRatBN7.2 4 171,029,666 - 171,044,893 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 171,029,630 - 171,044,892 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 177,324,703 - 177,339,950 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 173,108,869 - 173,124,108 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 171,729,410 - 171,744,649 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 172,119,382 - 172,134,609 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 172,119,331 - 172,134,607 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 236,372,225 - 236,387,452 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 175,248,654 - 175,263,881 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 159,602,240 - 159,617,460 (+) NCBI Celera RGSC_v3.1 4 175,493,783 - 175,509,005 (+) NCBI RH 3.4 Map 4 1032.9 RGD Cytogenetic Map 4 q44 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mgst1 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of MGST1 mRNA] CTD PMID:31150632 Mgst1 Rat (-)-epigallocatechin 3-gallate decreases activity EXP 6480464 epigallocatechin gallate results in decreased activity of MGST1 protein CTD PMID:23010222 Mgst1 Rat (E)-cinnamyl alcohol increases expression ISO MGST1 (Homo sapiens) 6480464 cinnamyl alcohol results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat (S)-amphetamine increases expression EXP 6480464 Dextroamphetamine results in increased expression of MGST1 mRNA CTD PMID:16715494 Mgst1 Rat 1,1'-azobis(N,N-dimethylformamide) multiple interactions EXP 6480464 [Diamide co-treated with Glutathione] results in increased activity of MGST1 protein; Bongkrekic Acid inhibits the more ... CTD PMID:18634816 Mgst1 Rat 1,1'-azobis(N,N-dimethylformamide) increases activity EXP 6480464 Diamide results in increased activity of MGST1 protein CTD PMID:18634816 Mgst1 Rat 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane increases expression ISO Mgst1 (Mus musculus) 6480464 2,2-bis(4-hydroxyphenyl)-1,1,1-trichloroethane results in increased expression of MGST1 mRNA CTD PMID:11509743 Mgst1 Rat 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Estradiol co-treated with 2,2-bis(4-hydroxyphenyl)-1,1,1-trichloroethane] results in increased expression of MGST1 mRNA CTD PMID:11509743 Mgst1 Rat 1,2-dimethylhydrazine multiple interactions ISO Mgst1 (Mus musculus) 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MGST1 mRNA CTD PMID:22206623 Mgst1 Rat 1,2-dimethylhydrazine decreases expression EXP 6480464 1,2-Dimethylhydrazine results in decreased expression of MGST1 mRNA CTD PMID:32028820 Mgst1 Rat 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1,2-Dimethylhydrazine co-treated with morin] results in increased expression of MGST1 mRNA CTD PMID:32028820 Mgst1 Rat 1,2-dimethylhydrazine decreases expression ISO Mgst1 (Mus musculus) 6480464 1,2-Dimethylhydrazine results in decreased expression of MGST1 mRNA CTD PMID:22206623 Mgst1 Rat 1,4-dithiothreitol multiple interactions EXP 6480464 Dithiothreitol inhibits the reaction [[1-hydroxy-2-oxo-3-(3-aminopropyl)-3-isopropyl-1-triazene results in increased abundance of Nitric Oxide] which results in more ... CTD PMID:16125204|PMID:16386761|PMID:18634816 Mgst1 Rat 1-chloro-2,4-dinitrobenzene increases expression ISO MGST1 (Homo sapiens) 6480464 Dinitrochlorobenzene results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat 17alpha-ethynylestradiol affects expression ISO Mgst1 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of MGST1 mRNA CTD PMID:17555576 Mgst1 Rat 17alpha-ethynylestradiol decreases expression ISO Mgst1 (Mus musculus) 6480464 Ethinyl Estradiol results in decreased expression of MGST1 mRNA CTD PMID:16174780|PMID:17942748 Mgst1 Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of MGST1 mRNA CTD PMID:12075121|PMID:16174780 Mgst1 Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of MGST1 mRNA CTD PMID:17108234 Mgst1 Rat 17alpha-ethynylestradiol multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in decreased expression of MGST1 mRNA CTD PMID:17942748 Mgst1 Rat 17beta-estradiol multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Estradiol co-treated with 2,2-bis(4-hydroxyphenyl)-1,1,1-trichloroethane] results in increased expression of MGST1 mRNA; [Estradiol co-treated with Methoxychlor more ... CTD PMID:11509743 Mgst1 Rat 17beta-estradiol multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of MGST1 mRNA; [Estradiol co-treated with TGFB1 more ... CTD PMID:17982697|PMID:20660070|PMID:30165855 Mgst1 Rat 17beta-estradiol decreases expression ISO MGST1 (Homo sapiens) 6480464 Estradiol results in decreased expression of MGST1 mRNA CTD PMID:17982697 Mgst1 Rat 17beta-estradiol increases expression ISO Mgst1 (Mus musculus) 6480464 Estradiol results in increased expression of MGST1 mRNA CTD PMID:11509743|PMID:39298647 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO MGST1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MGST1 mRNA CTD PMID:17101203 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of MGST1 mRNA CTD PMID:34747641 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Mgst1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of MGST1 mRNA CTD PMID:15034205|PMID:19474220 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO MGST1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of MGST1 mRNA CTD PMID:20106945|PMID:21632981 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Mgst1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MGST1 mRNA CTD PMID:21570461 Mgst1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in decreased expression of MGST1 mRNA; NFE2L2 protein affects more ... CTD PMID:16054899|PMID:17942748|PMID:19474220|PMID:19654925 Mgst1 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Mgst1 (Mus musculus) 6480464 2,2',4,4',5-brominated diphenyl ether affects the expression of MGST1 mRNA CTD PMID:38648751 Mgst1 Rat 2,6-dimethoxyphenol multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1,3-dimethyl ether] results in increased expression of MGST1 protein; [Sodium Chloride more ... CTD PMID:38598786 Mgst1 Rat 2-amino-2-deoxy-D-galactopyranose multiple interactions EXP 6480464 [Galactosamine co-treated with Lipopolysaccharides] results in increased activity of MGST1 protein; Dithiothreitol inhibits the reaction more ... CTD PMID:18634816 Mgst1 Rat 2-bromohexadecanoic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in more ... CTD PMID:38195004 Mgst1 Rat 2-palmitoylglycerol increases expression ISO MGST1 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of MGST1 mRNA CTD PMID:37199045 Mgst1 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO MGST1 (Homo sapiens) 6480464 3,4,5,3',4'-pentachlorobiphenyl results in increased expression of MGST1 mRNA CTD PMID:21703328 Mgst1 Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of MGST1 protein CTD PMID:34915118 Mgst1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in increased expression more ... CTD PMID:16054899 Mgst1 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Mgst1 (Mus musculus) 6480464 4,4'-diaminodiphenylmethane results in decreased expression of MGST1 mRNA CTD PMID:18648102 Mgst1 Rat 4,4'-sulfonyldiphenol increases expression ISO Mgst1 (Mus musculus) 6480464 bisphenol S results in increased expression of MGST1 mRNA CTD PMID:39298647 Mgst1 Rat 4,4'-sulfonyldiphenol affects expression ISO MGST1 (Homo sapiens) 6480464 bisphenol S affects the expression of MGST1 protein CTD PMID:31945527 Mgst1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of MGST1 mRNA CTD PMID:24780913 Mgst1 Rat 8-Br-cAMP increases expression ISO MGST1 (Homo sapiens) 6480464 8-Bromo Cyclic Adenosine Monophosphate results in increased expression of MGST1 mRNA CTD PMID:22079614 Mgst1 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of MGST1 mRNA CTD PMID:31881176 Mgst1 Rat aconitine decreases expression EXP 6480464 Aconitine results in decreased expression of MGST1 protein CTD PMID:33236894 Mgst1 Rat acrolein affects activity EXP 6480464 Acrolein affects the activity of MGST1 protein CTD PMID:28780321 Mgst1 Rat aflatoxin B1 decreases methylation ISO MGST1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of MGST1 gene CTD PMID:27153756 Mgst1 Rat aflatoxin M1 decreases expression ISO MGST1 (Homo sapiens) 6480464 Aflatoxin M1 results in decreased expression of MGST1 mRNA CTD PMID:30928695 Mgst1 Rat all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of MGST1 mRNA CTD PMID:20488242 Mgst1 Rat all-trans-retinoic acid decreases expression ISO MGST1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of MGST1 mRNA CTD PMID:21934132|PMID:23724009|PMID:33167477 Mgst1 Rat alpha-hexylcinnamaldehyde increases expression ISO MGST1 (Homo sapiens) 6480464 hexyl cinnamic aldehyde results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat amiodarone increases expression ISO MGST1 (Homo sapiens) 6480464 Amiodarone results in increased expression of MGST1 mRNA CTD PMID:19774075 Mgst1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of MGST1 mRNA CTD PMID:16483693 Mgst1 Rat antimonite multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Antimony Potassium Tartrate results in increased abundance of antimonite] which results in increased expression of more ... CTD PMID:32076005 Mgst1 Rat Aroclor 1254 decreases expression ISO Mgst1 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of MGST1 mRNA CTD PMID:23650126 Mgst1 Rat arsane increases expression ISO MGST1 (Homo sapiens) 6480464 Arsenic results in increased expression of MGST1 mRNA CTD PMID:19945496 Mgst1 Rat arsane multiple interactions ISO MGST1 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MGST1 more ... CTD PMID:32525701 Mgst1 Rat arsenic atom increases expression ISO MGST1 (Homo sapiens) 6480464 Arsenic results in increased expression of MGST1 mRNA CTD PMID:19945496 Mgst1 Rat arsenic atom multiple interactions ISO MGST1 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MGST1 more ... CTD PMID:32525701 Mgst1 Rat arsenite(3-) multiple interactions ISO MGST1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of arsenite] which results in increased expression of MGST1 more ... CTD PMID:32076005|PMID:32406909 Mgst1 Rat arsenous acid increases expression ISO Mgst1 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of MGST1 mRNA CTD PMID:26187899 Mgst1 Rat arsenous acid multiple interactions ISO Mgst1 (Mus musculus) 6480464 Arsenic Trioxide promotes the reaction [Lutein results in increased expression of MGST1 mRNA]; Lutein promotes more ... CTD PMID:25815309|PMID:26187899 Mgst1 Rat atrazine increases expression EXP 6480464 Atrazine results in increased expression of MGST1 mRNA CTD PMID:28882082 Mgst1 Rat Azaspiracid increases expression ISO MGST1 (Homo sapiens) 6480464 azaspiracid results in increased expression of MGST1 mRNA CTD PMID:28939011 Mgst1 Rat Bandrowski's base increases expression ISO MGST1 (Homo sapiens) 6480464 Bandrowski's base results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat benzo[a]pyrene increases expression ISO Mgst1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of MGST1 mRNA CTD PMID:15034205|PMID:22228805 Mgst1 Rat benzo[a]pyrene increases methylation ISO MGST1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of MGST1 5' UTR; Benzo(a)pyrene results in increased methylation of more ... CTD PMID:27901495 Mgst1 Rat benzo[a]pyrene increases expression ISO MGST1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of MGST1 mRNA CTD PMID:20106945|PMID:21632981|PMID:22316170|PMID:26238291 Mgst1 Rat benzo[a]pyrene diol epoxide I increases expression ISO MGST1 (Homo sapiens) 6480464 7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in increased expression of MGST1 mRNA CTD PMID:17944540 Mgst1 Rat beta-lapachone increases expression ISO MGST1 (Homo sapiens) 6480464 beta-lapachone results in increased expression of MGST1 mRNA CTD PMID:38218311 Mgst1 Rat beta-naphthoflavone increases expression ISO MGST1 (Homo sapiens) 6480464 beta-Naphthoflavone results in increased expression of MGST1 mRNA CTD PMID:32858204 Mgst1 Rat bis(2-chloroethyl) sulfide increases expression ISO Mgst1 (Mus musculus) 6480464 Mustard Gas results in increased expression of MGST1 mRNA CTD PMID:15674843|PMID:18955075 Mgst1 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat bis(2-ethylhexyl) phthalate increases expression ISO Mgst1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of MGST1 mRNA CTD PMID:33754040 Mgst1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Mgst1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of MGST1 mRNA CTD PMID:34319233 Mgst1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MGST1 mRNA CTD PMID:12075121 Mgst1 Rat bisphenol A increases expression ISO MGST1 (Homo sapiens) 6480464 bisphenol A results in increased expression of MGST1 protein CTD PMID:34186270 Mgst1 Rat bisphenol A affects expression ISO MGST1 (Homo sapiens) 6480464 bisphenol A affects the expression of MGST1 mRNA CTD PMID:30903817 Mgst1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MGST1 mRNA CTD PMID:30903817 Mgst1 Rat bisphenol A multiple interactions ISO Mgst1 (Mus musculus) 6480464 [LRAT gene mutant form affects the susceptibility to [bisphenol A co-treated with retinol acetate]] which more ... CTD PMID:28123100 Mgst1 Rat bisphenol A increases expression ISO Mgst1 (Mus musculus) 6480464 bisphenol A results in increased expression of MGST1 mRNA CTD PMID:28123100|PMID:33221593 Mgst1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of MGST1 gene CTD PMID:28505145 Mgst1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MGST1 mRNA CTD PMID:25181051|PMID:33296240 Mgst1 Rat bisphenol A increases methylation ISO MGST1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of MGST1 gene CTD PMID:22576693 Mgst1 Rat bisphenol A decreases expression ISO MGST1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of MGST1 mRNA; bisphenol A results in decreased expression more ... CTD PMID:22576693|PMID:37567409 Mgst1 Rat bisphenol AF increases expression ISO MGST1 (Homo sapiens) 6480464 bisphenol AF results in increased expression of MGST1 protein CTD PMID:34186270 Mgst1 Rat Bisphenol B increases expression ISO MGST1 (Homo sapiens) 6480464 bisphenol B results in increased expression of MGST1 protein CTD PMID:34186270 Mgst1 Rat bisphenol F increases expression ISO MGST1 (Homo sapiens) 6480464 bisphenol F results in increased expression of MGST1 protein CTD PMID:34186270 Mgst1 Rat bongkrekic acid multiple interactions EXP 6480464 Bongkrekic Acid inhibits the reaction [[Diamide co-treated with Glutathione] results in increased activity of MGST1 more ... CTD PMID:18634816 Mgst1 Rat bosentan decreases expression ISO MGST1 (Homo sapiens) 6480464 Bosentan results in decreased expression of MGST1 mRNA CTD PMID:29761207 Mgst1 Rat buta-1,3-diene increases expression ISO Mgst1 (Mus musculus) 6480464 1,3-butadiene results in increased expression of MGST1 mRNA CTD PMID:29038090 Mgst1 Rat Butylbenzyl phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat cadmium atom multiple interactions ISO MGST1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in more ... CTD PMID:29741670|PMID:35301059|PMID:38195004 Mgst1 Rat cadmium dichloride multiple interactions ISO MGST1 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in more ... CTD PMID:29741670|PMID:35301059|PMID:38195004 Mgst1 Rat caffeine decreases expression ISO MGST1 (Homo sapiens) 6480464 Caffeine results in decreased expression of MGST1 mRNA CTD PMID:11793227 Mgst1 Rat carbamazepine affects expression ISO MGST1 (Homo sapiens) 6480464 Carbamazepine affects the expression of MGST1 mRNA CTD PMID:25979313 Mgst1 Rat carbon nanotube decreases expression ISO Mgst1 (Mus musculus) 6480464 Nanotubes, Carbon analog results in decreased expression of MGST1 mRNA; Nanotubes, Carbon results in decreased more ... CTD PMID:25554681 Mgst1 Rat carbon nanotube increases expression ISO Mgst1 (Mus musculus) 6480464 Nanotubes, Carbon results in increased expression of MGST1 mRNA CTD PMID:25620056 Mgst1 Rat chenodeoxycholic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat chlordecone increases expression ISO Mgst1 (Mus musculus) 6480464 Chlordecone results in increased expression of MGST1 mRNA CTD PMID:33711761 Mgst1 Rat chlorogenic acid decreases activity EXP 6480464 Chlorogenic Acid results in decreased activity of MGST1 protein CTD PMID:16125204 Mgst1 Rat cinnamyl alcohol increases expression ISO MGST1 (Homo sapiens) 6480464 cinnamyl alcohol results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat ciprofibrate increases expression ISO Mgst1 (Mus musculus) 6480464 ciprofibrate results in increased expression of MGST1 mRNA CTD PMID:18723825 Mgst1 Rat cis-caffeic acid increases activity EXP 6480464 caffeic acid results in increased activity of MGST1 protein CTD PMID:16125204 Mgst1 Rat cisplatin increases expression ISO Mgst1 (Mus musculus) 6480464 Cisplatin results in increased expression of MGST1 mRNA CTD PMID:21151649 Mgst1 Rat cisplatin decreases response to substance ISO MGST1 (Homo sapiens) 6480464 MGST1 protein results in decreased susceptibility to Cisplatin CTD PMID:20727966 Mgst1 Rat clofibrate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of MGST1 mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Mgst1 Rat clofibrate increases expression ISO Mgst1 (Mus musculus) 6480464 Clofibrate results in increased expression of MGST1 mRNA CTD PMID:18723825 Mgst1 Rat cobalt dichloride increases expression ISO MGST1 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of MGST1 mRNA CTD PMID:17553155 Mgst1 Rat copper atom multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of MGST1 mRNA CTD PMID:30911355 Mgst1 Rat copper(0) multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of MGST1 mRNA CTD PMID:30911355 Mgst1 Rat crocidolite asbestos decreases expression ISO Mgst1 (Mus musculus) 6480464 Asbestos, Crocidolite results in decreased expression of MGST1 mRNA CTD PMID:29279043 Mgst1 Rat cumene hydroperoxide decreases response to substance EXP 6480464 MGST1 results in decreased susceptibility to cumene hydroperoxide CTD PMID:17306223 Mgst1 Rat curcumin increases expression EXP 6480464 Curcumin results in increased expression of MGST1 mRNA CTD PMID:18299980 Mgst1 Rat cyclophosphamide decreases expression EXP 6480464 Cyclophosphamide results in decreased expression of MGST1 mRNA CTD PMID:11906922 Mgst1 Rat cyclosporin A multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [[Diamide co-treated with Glutathione] results in increased activity of MGST1 protein]; more ... CTD PMID:18634816|PMID:19111564 Mgst1 Rat cyclosporin A increases expression ISO MGST1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of MGST1 mRNA CTD PMID:25562108 Mgst1 Rat deoxycholic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat dexamethasone multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in increased expression more ... CTD PMID:16054899 Mgst1 Rat dexamethasone increases expression ISO MGST1 (Homo sapiens) 6480464 Dexamethasone results in increased expression of MGST1 mRNA CTD PMID:25047013 Mgst1 Rat dexamethasone increases expression ISO Mgst1 (Mus musculus) 6480464 Dexamethasone results in increased expression of MGST1 mRNA CTD PMID:18723825|PMID:22733784 Mgst1 Rat diarsenic trioxide multiple interactions ISO Mgst1 (Mus musculus) 6480464 Arsenic Trioxide promotes the reaction [Lutein results in increased expression of MGST1 mRNA]; Lutein promotes more ... CTD PMID:25815309|PMID:26187899 Mgst1 Rat diarsenic trioxide increases expression ISO Mgst1 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of MGST1 mRNA CTD PMID:26187899 Mgst1 Rat diazinon increases expression EXP 6480464 Diazinon results in increased expression of MGST1 mRNA CTD PMID:19440498 Mgst1 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of MGST1 mRNA CTD PMID:21266533 Mgst1 Rat dibutyl phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat dichlorine decreases expression EXP 6480464 Chlorine results in decreased expression of MGST1 mRNA CTD PMID:18636392 Mgst1 Rat dichlorine multiple interactions EXP 6480464 [Ozone co-treated with Chlorine] affects the expression of MGST1 mRNA CTD PMID:18636392 Mgst1 Rat dichloromethane multiple interactions ISO Mgst1 (Mus musculus) 6480464 [propylene dichloride co-treated with Methylene Chloride] affects the activity of and affects the expression of more ... CTD PMID:30240022 Mgst1 Rat dicyclanil increases expression ISO Mgst1 (Mus musculus) 6480464 dicyclanil results in increased expression of MGST1 mRNA CTD PMID:15664270 Mgst1 Rat diethyl phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat diisobutyl phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat diisononyl phthalate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated more ... CTD PMID:39150890 Mgst1 Rat dimethylarsinic acid increases expression EXP 6480464 Cacodylic Acid results in increased expression of MGST1 mRNA CTD PMID:16122865 Mgst1 Rat dinophysistoxin 1 increases expression ISO MGST1 (Homo sapiens) 6480464 dinophysistoxin 1 results in increased expression of MGST1 mRNA CTD PMID:28939011 Mgst1 Rat dioxygen increases expression ISO Mgst1 (Mus musculus) 6480464 Oxygen results in increased expression of MGST1 mRNA; Oxygen results in increased expression of MGST1 more ... CTD PMID:23337360 Mgst1 Rat dioxygen multiple interactions ISO Mgst1 (Mus musculus) 6480464 AHR protein affects the reaction [Oxygen results in increased expression of MGST1 protein] CTD PMID:23337360 Mgst1 Rat dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Antimony Potassium Tartrate results in increased abundance of antimonite] which results in increased expression of more ... CTD PMID:32076005 Mgst1 Rat diquat increases expression ISO Mgst1 (Mus musculus) 6480464 Diquat results in increased expression of MGST1 mRNA CTD PMID:36851058 Mgst1 Rat disodium selenite decreases expression ISO MGST1 (Homo sapiens) 6480464 Sodium Selenite results in decreased expression of MGST1 mRNA CTD PMID:16705456 Mgst1 Rat disodium selenite increases expression ISO MGST1 (Homo sapiens) 6480464 Sodium Selenite results in increased expression of MGST1 mRNA CTD PMID:18175754 Mgst1 Rat disulfiram increases expression ISO MGST1 (Homo sapiens) 6480464 Disulfiram results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat dorsomorphin multiple interactions ISO MGST1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mgst1 Rat doxorubicin increases expression EXP 6480464 Doxorubicin results in increased expression of MGST1 mRNA CTD PMID:19915844 Mgst1 Rat ellagic acid decreases activity EXP 6480464 Ellagic Acid results in decreased activity of MGST1 protein CTD PMID:16125204 Mgst1 Rat emamectin benzoate increases expression ISO Mgst1 (Mus musculus) 6480464 emamectin benzoate results in increased expression of MGST1 mRNA CTD PMID:29268245 Mgst1 Rat emamectin benzoate multiple interactions ISO Mgst1 (Mus musculus) 6480464 Plant Oils inhibits the reaction [emamectin benzoate results in increased expression of MGST1 mRNA] CTD PMID:29268245 Mgst1 Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of MGST1 mRNA CTD PMID:29391264 Mgst1 Rat ethoxyquin increases expression ISO Mgst1 (Mus musculus) 6480464 Ethoxyquin results in increased expression of MGST1 mRNA CTD PMID:18723825 Mgst1 Rat eugenol increases expression ISO MGST1 (Homo sapiens) 6480464 Eugenol results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat ferric oxide increases expression EXP 6480464 ferric oxide analog results in increased expression of MGST1 mRNA CTD PMID:38615722 Mgst1 Rat flutamide decreases expression ISO Mgst1 (Mus musculus) 6480464 Flutamide results in decreased expression of MGST1 mRNA CTD PMID:11509743 Mgst1 Rat folic acid multiple interactions ISO Mgst1 (Mus musculus) 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MGST1 mRNA CTD PMID:22206623 Mgst1 Rat folic acid decreases expression ISO Mgst1 (Mus musculus) 6480464 Folic Acid results in decreased expression of MGST1 mRNA CTD PMID:25629700 Mgst1 Rat furan increases methylation EXP 6480464 furan results in increased methylation of MGST1 gene CTD PMID:22079235 Mgst1 Rat furfural multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1,3-dimethyl ether] results in increased expression of MGST1 protein CTD PMID:38598786 Mgst1 Rat gallic acid multiple interactions EXP 6480464 1,1-diphenyl-2-picrylhydrazyl inhibits the reaction [Gallic Acid results in increased activity of MGST1 protein]; Cyclosporine inhibits more ... CTD PMID:16125204|PMID:19111564 Mgst1 Rat gallic acid increases activity EXP 6480464 Gallic Acid results in increased activity of MGST1 protein CTD PMID:16125204|PMID:19111564 Mgst1 Rat genistein decreases expression EXP 6480464 Genistein results in decreased expression of MGST1 mRNA CTD PMID:12075121 Mgst1 Rat genistein multiple interactions EXP 6480464 [Genistein co-treated with Methoxychlor] results in decreased expression of MGST1 mRNA CTD PMID:21782745 Mgst1 Rat genistein decreases expression ISO Mgst1 (Mus musculus) 6480464 Genistein results in decreased expression of MGST1 mRNA CTD PMID:24967385 Mgst1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of MGST1 mRNA CTD PMID:22061828 Mgst1 Rat glutathione multiple interactions EXP 6480464 [Diamide co-treated with Glutathione] results in increased activity of MGST1 protein; [Peroxynitrous Acid co-treated with more ... CTD PMID:12470677|PMID:16386761|PMID:18634816|PMID:9890956 Mgst1 Rat glycochenodeoxycholic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat glycocholic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat glycodeoxycholic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat hemin multiple interactions EXP 6480464 Hemin inhibits the reaction [Gallic Acid results in increased activity of MGST1 protein] CTD PMID:19111564 Mgst1 Rat hydrogen peroxide decreases response to substance EXP 6480464 MGST1 results in decreased susceptibility to Hydrogen Peroxide CTD PMID:17306223 Mgst1 Rat hydroquinone increases expression ISO MGST1 (Homo sapiens) 6480464 hydroquinone results in increased expression of MGST1 mRNA CTD PMID:15452088 Mgst1 Rat inulin multiple interactions ISO Mgst1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of MGST1 mRNA CTD PMID:36331819 Mgst1 Rat iron trichloride multiple interactions EXP 6480464 ferric chloride inhibits the reaction [Gallic Acid results in increased activity of MGST1 protein] CTD PMID:16125204 Mgst1 Rat isoeugenol increases expression ISO MGST1 (Homo sapiens) 6480464 isoeugenol results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat isoniazide increases expression ISO Mgst1 (Mus musculus) 6480464 Isoniazid results in increased expression of MGST1 mRNA CTD PMID:33771660 Mgst1 Rat isoprenaline increases expression ISO Mgst1 (Mus musculus) 6480464 Isoproterenol results in increased expression of MGST1 mRNA CTD PMID:20003209|PMID:21335049 Mgst1 Rat ivermectin decreases expression ISO MGST1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of MGST1 protein CTD PMID:32959892 Mgst1 Rat ketoconazole increases expression EXP 6480464 Ketoconazole results in increased expression of MGST1 mRNA CTD PMID:37077353 Mgst1 Rat kojic acid multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with kojic acid co-treated with Diethylnitrosamine] results in decreased expression of MGST1 mRNA; more ... CTD PMID:18544905 Mgst1 Rat L-1,4-dithiothreitol multiple interactions EXP 6480464 Dithiothreitol inhibits the reaction [[1-hydroxy-2-oxo-3-(3-aminopropyl)-3-isopropyl-1-triazene results in increased abundance of Nitric Oxide] which results in more ... CTD PMID:16125204|PMID:16386761|PMID:18634816 Mgst1 Rat L-ascorbic acid increases expression EXP 6480464 Ascorbic Acid results in increased expression of MGST1 mRNA CTD PMID:15372504 Mgst1 Rat lead diacetate increases expression EXP 6480464 lead acetate results in increased expression of MGST1 mRNA CTD PMID:11578147|PMID:22641619 Mgst1 Rat lead diacetate increases expression ISO MGST1 (Homo sapiens) 6480464 lead acetate results in increased expression of MGST1 mRNA CTD PMID:38568856 Mgst1 Rat lead nitrate multiple interactions ISO Mgst1 (Mus musculus) 6480464 lead nitrate affects the reaction [MGST1 affects the expression of MT1 mRNA]; lead nitrate affects more ... CTD PMID:11891201 Mgst1 Rat leukotriene A4 decreases activity EXP 6480464 Leukotriene A4 results in decreased activity of MGST1 protein CTD PMID:9890956 Mgst1 Rat leukotriene B4 decreases activity EXP 6480464 Leukotriene B4 results in decreased activity of MGST1 protein CTD PMID:9890956 Mgst1 Rat leukotriene C4 multiple interactions EXP 6480464 Leukotriene C4 binds to and results in decreased activity of MGST1 protein; Leukotriene C4 inhibits more ... CTD PMID:9890956 Mgst1 Rat leukotriene D4 decreases activity EXP 6480464 Leukotriene D4 results in decreased activity of MGST1 protein CTD PMID:9890956 Mgst1 Rat leukotriene E4 decreases activity EXP 6480464 Leukotriene E4 results in decreased activity of MGST1 protein CTD PMID:9890956 Mgst1 Rat lipopolysaccharide multiple interactions EXP 6480464 [Galactosamine co-treated with Lipopolysaccharides] results in increased activity of MGST1 protein; Dithiothreitol inhibits the reaction more ... CTD PMID:18634816 Mgst1 Rat lutein multiple interactions ISO Mgst1 (Mus musculus) 6480464 arsenic trioxide promotes the reaction [Lutein results in increased expression of MGST1 mRNA]; Lutein promotes more ... CTD PMID:25815309|PMID:26187899 Mgst1 Rat lutein increases expression ISO Mgst1 (Mus musculus) 6480464 Lutein results in increased expression of MGST1 mRNA CTD PMID:25815309|PMID:26187899 Mgst1 Rat manganese(II) chloride decreases expression EXP 6480464 manganese chloride results in decreased expression of MGST1 mRNA CTD PMID:28801915 Mgst1 Rat medroxyprogesterone acetate increases expression ISO MGST1 (Homo sapiens) 6480464 Medroxyprogesterone Acetate results in increased expression of MGST1 mRNA CTD PMID:20843944 Mgst1 Rat methimazole increases expression ISO MGST1 (Homo sapiens) 6480464 Methimazole results in increased expression of MGST1 mRNA CTD PMID:20144635 Mgst1 Rat methoxyacetic acid affects expression EXP 6480464 methoxyacetic acid affects the expression of MGST1 mRNA CTD PMID:20864626 Mgst1 Rat methoxychlor multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Estradiol co-treated with Methoxychlor metabolite] results in increased expression of MGST1 mRNA CTD PMID:11509743 Mgst1 Rat methoxychlor multiple interactions EXP 6480464 [Genistein co-treated with Methoxychlor] results in decreased expression of MGST1 mRNA CTD PMID:21782745 Mgst1 Rat methoxychlor increases expression ISO Mgst1 (Mus musculus) 6480464 Methoxychlor metabolite results in increased expression of MGST1 mRNA CTD PMID:11509743 Mgst1 Rat methyl methanesulfonate decreases expression ISO MGST1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of MGST1 mRNA CTD PMID:23649840 Mgst1 Rat methylmercury chloride increases expression ISO Mgst1 (Mus musculus) 6480464 methylmercuric chloride results in increased expression of MGST1 mRNA CTD PMID:20061341 Mgst1 Rat methylmercury chloride increases expression ISO MGST1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of MGST1 mRNA CTD PMID:28001369 Mgst1 Rat microcystin affects expression EXP 6480464 Microcystins affects the expression of MGST1 mRNA CTD PMID:19790251 Mgst1 Rat microcystin increases expression EXP 6480464 Microcystins results in increased expression of MGST1 mRNA CTD PMID:19790251 Mgst1 Rat morin multiple interactions EXP 6480464 [1,2-Dimethylhydrazine co-treated with morin] results in increased expression of MGST1 mRNA CTD PMID:32028820 Mgst1 Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal increases expression ISO Mgst1 (Mus musculus) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of MGST1 mRNA CTD PMID:20061341 Mgst1 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with kojic acid co-treated with Diethylnitrosamine] results in decreased expression of MGST1 mRNA; more ... CTD PMID:18544905|PMID:20935162 Mgst1 Rat nickel atom decreases expression ISO MGST1 (Homo sapiens) 6480464 Nickel results in decreased expression of MGST1 mRNA CTD PMID:24768652|PMID:25583101 Mgst1 Rat nickel sulfate increases expression ISO MGST1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of MGST1 mRNA CTD PMID:20566472|PMID:22714537 Mgst1 Rat nitric oxide multiple interactions EXP 6480464 [1-hydroxy-2-oxo-3-(3-aminopropyl)-3-isopropyl-1-triazene results in increased abundance of Nitric Oxide] which results in increased activity of MGST1 more ... CTD PMID:16386761 Mgst1 Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of MGST1 mRNA CTD PMID:33484710 Mgst1 Rat O-acetyl-L-carnitine increases expression EXP 6480464 Acetylcarnitine results in increased expression of MGST1 mRNA CTD PMID:14654561 Mgst1 Rat ochratoxin A decreases expression EXP 6480464 ochratoxin A results in decreased expression of MGST1 mRNA CTD PMID:17483316|PMID:22124623|PMID:23358140 Mgst1 Rat ochratoxin A affects expression ISO MGST1 (Homo sapiens) 6480464 ochratoxin A affects the expression of MGST1 mRNA CTD PMID:32905824 Mgst1 Rat ozone multiple interactions EXP 6480464 [Ozone co-treated with Chlorine] affects the expression of MGST1 mRNA CTD PMID:18636392 Mgst1 Rat paracetamol multiple interactions ISO Mgst1 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of MGST1 mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Mgst1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of MGST1 mRNA CTD PMID:33387578 Mgst1 Rat paracetamol multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat paracetamol affects expression ISO MGST1 (Homo sapiens) 6480464 Acetaminophen affects the expression of MGST1 mRNA CTD PMID:25704631 Mgst1 Rat paracetamol affects expression ISO Mgst1 (Mus musculus) 6480464 Acetaminophen affects the expression of MGST1 mRNA CTD PMID:17562736 Mgst1 Rat paracetamol decreases expression ISO MGST1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of MGST1 mRNA CTD PMID:11793227|PMID:29067470 Mgst1 Rat paracetamol decreases expression ISO Mgst1 (Mus musculus) 6480464 Acetaminophen results in decreased expression of MGST1 protein CTD PMID:21329376 Mgst1 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of MGST1 mRNA CTD PMID:17935786 Mgst1 Rat paraquat affects expression ISO Mgst1 (Mus musculus) 6480464 Paraquat affects the expression of MGST1 mRNA CTD PMID:27788593 Mgst1 Rat parathion multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Parathion co-treated with Estradiol] results in increased expression of MGST1 mRNA CTD PMID:17982697 Mgst1 Rat parathion increases expression ISO MGST1 (Homo sapiens) 6480464 Parathion results in increased expression of MGST1 mRNA CTD PMID:17982697 Mgst1 Rat perfluorohexanesulfonic acid increases expression ISO Mgst1 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of MGST1 mRNA CTD PMID:37995155 Mgst1 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Mgst1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of MGST1 mRNA; [perfluorooctane sulfonic more ... CTD PMID:36331819 Mgst1 Rat peroxynitrous acid multiple interactions EXP 6480464 [Peroxynitrous Acid co-treated with Glutathione] results in increased activity of MGST1 protein; Dithiothreitol inhibits the more ... CTD PMID:16386761 Mgst1 Rat peroxynitrous acid increases activity EXP 6480464 Peroxynitrous Acid results in increased activity of MGST1 protein CTD PMID:16386761 Mgst1 Rat phenobarbital multiple interactions EXP 6480464 [Phenobarbital co-treated with Diethylnitrosamine] results in increased expression of MGST1 protein CTD PMID:20935162 Mgst1 Rat PhIP decreases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in decreased expression of MGST1 mRNA CTD PMID:33945839 Mgst1 Rat phlorizin increases expression ISO Mgst1 (Mus musculus) 6480464 Phlorhizin results in increased expression of MGST1 mRNA CTD PMID:22538082 Mgst1 Rat pirinixic acid increases expression ISO Mgst1 (Mus musculus) 6480464 pirinixic acid results in increased expression of MGST1 mRNA CTD PMID:17426115 Mgst1 Rat poly(I:C) multiple interactions ISO MGST1 (Homo sapiens) 6480464 [TL8-506 co-treated with Poly I-C] results in increased expression of MGST1 mRNA CTD PMID:35688559 Mgst1 Rat progesterone multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in increased expression of MGST1 mRNA CTD PMID:20660070 Mgst1 Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of MGST1 mRNA CTD PMID:20726854 Mgst1 Rat propiconazole increases expression ISO Mgst1 (Mus musculus) 6480464 propiconazole results in increased expression of MGST1 mRNA CTD PMID:21278054 Mgst1 Rat protein kinase inhibitor multiple interactions ISO MGST1 (Homo sapiens) 6480464 Protein Kinase Inhibitors inhibits the reaction [gardiquimod results in decreased expression of MGST1 mRNA] CTD PMID:28003376 Mgst1 Rat pyrimidin-2-amine affects binding EXP 6480464 2-aminopyrimidine analog binds to MGST1 protein CTD PMID:19317514 Mgst1 Rat quercetin affects expression EXP 6480464 Quercetin affects the expression of MGST1 mRNA CTD PMID:18178720 Mgst1 Rat quercetin decreases activity EXP 6480464 Quercetin results in decreased activity of MGST1 protein CTD PMID:16125204 Mgst1 Rat rac-1,2-dichloropropane multiple interactions ISO Mgst1 (Mus musculus) 6480464 [propylene dichloride co-treated with Methylene Chloride] affects the activity of and affects the expression of more ... CTD PMID:30240022 Mgst1 Rat reactive oxygen species increases activity EXP 6480464 Reactive Oxygen Species results in increased activity of MGST1 protein CTD PMID:16386761 Mgst1 Rat retinyl acetate increases expression ISO Mgst1 (Mus musculus) 6480464 retinol acetate results in increased expression of MGST1 mRNA CTD PMID:28123100 Mgst1 Rat retinyl acetate multiple interactions ISO Mgst1 (Mus musculus) 6480464 [LRAT gene mutant form affects the susceptibility to [bisphenol A co-treated with retinol acetate]] which more ... CTD PMID:28123100 Mgst1 Rat rotenone affects expression ISO Mgst1 (Mus musculus) 6480464 Rotenone affects the expression of MGST1 mRNA CTD PMID:23186747 Mgst1 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of MGST1 mRNA CTD PMID:28374803 Mgst1 Rat S-nitroso-L-cysteine multiple interactions EXP 6480464 [S-nitrosocysteine results in increased abundance of Nitric Oxide] which results in increased activity of MGST1 more ... CTD PMID:16386761 Mgst1 Rat S-nitrosoglutathione affects metabolic processing EXP 6480464 S-Nitrosoglutathione affects the metabolism of MGST1 protein CTD PMID:16899233 Mgst1 Rat S-nitrosoglutathione multiple interactions EXP 6480464 [S-Nitrosoglutathione results in increased abundance of Nitric Oxide] which results in increased activity of MGST1 more ... CTD PMID:16386761 Mgst1 Rat SB 431542 multiple interactions ISO MGST1 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide co-treated with FGF2 protein] results in decreased expression of MGST1 more ... CTD PMID:27188386|PMID:37664457 Mgst1 Rat serpentine asbestos increases expression ISO MGST1 (Homo sapiens) 6480464 Asbestos, Serpentine results in increased expression of MGST1 mRNA CTD PMID:29523930 Mgst1 Rat silver atom increases expression ISO Mgst1 (Mus musculus) 6480464 Silver results in increased expression of MGST1 mRNA CTD PMID:27131904 Mgst1 Rat silver(0) increases expression ISO Mgst1 (Mus musculus) 6480464 Silver results in increased expression of MGST1 mRNA CTD PMID:27131904 Mgst1 Rat sodium arsenate multiple interactions ISO MGST1 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MGST1 more ... CTD PMID:32525701 Mgst1 Rat sodium arsenite increases expression ISO MGST1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MGST1 mRNA CTD PMID:22714537 Mgst1 Rat sodium arsenite decreases expression ISO Mgst1 (Mus musculus) 6480464 sodium arsenite results in decreased expression of MGST1 mRNA CTD PMID:37682722 Mgst1 Rat sodium arsenite multiple interactions ISO MGST1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of arsenite] which results in increased expression of MGST1 more ... CTD PMID:32076005 Mgst1 Rat sodium arsenite multiple interactions EXP 6480464 sodium arsenite inhibits the reaction [[Peroxynitrous Acid co-treated with Glutathione] results in increased activity of more ... CTD PMID:16125204|PMID:16386761 Mgst1 Rat sodium chloride multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1,3-dimethyl ether] results in increased expression of MGST1 protein CTD PMID:38598786 Mgst1 Rat sodium dichromate increases expression EXP 6480464 sodium bichromate results in increased expression of MGST1 mRNA CTD PMID:12325037 Mgst1 Rat spironolactone increases expression ISO Mgst1 (Mus musculus) 6480464 Spironolactone results in increased expression of MGST1 mRNA CTD PMID:18723825 Mgst1 Rat sunitinib decreases expression ISO MGST1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of MGST1 mRNA CTD PMID:31533062 Mgst1 Rat Sunset Yellow FCF multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat tamoxifen affects expression ISO Mgst1 (Mus musculus) 6480464 Tamoxifen affects the expression of MGST1 mRNA CTD PMID:17555576 Mgst1 Rat tartrazine multiple interactions ISO MGST1 (Homo sapiens) 6480464 [Glycochenodeoxycholic Acid co-treated with Deoxycholic Acid co-treated with Chenodeoxycholic Acid co-treated with Glycodeoxycholic Acid co-treated more ... CTD PMID:33819548 Mgst1 Rat tetrachloroethene increases expression ISO Mgst1 (Mus musculus) 6480464 Tetrachloroethylene results in increased expression of MGST1 mRNA CTD PMID:28973375 Mgst1 Rat tetrachloromethane affects expression EXP 6480464 Carbon Tetrachloride affects the expression of MGST1 mRNA CTD PMID:12734012|PMID:17805973 Mgst1 Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of MGST1 mRNA] CTD PMID:31150632 Mgst1 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of MGST1 mRNA CTD PMID:31150632 Mgst1 Rat tetrachloromethane decreases expression ISO Mgst1 (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of MGST1 mRNA CTD PMID:15056808 Mgst1 Rat thioacetamide decreases expression ISO MGST1 (Homo sapiens) 6480464 Thioacetamide results in decreased expression of MGST1 mRNA CTD PMID:11793227 Mgst1 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of MGST1 mRNA CTD PMID:34492290 Mgst1 Rat tolcapone affects binding EXP 6480464 tolcapone binds to MGST1 protein CTD PMID:19783845 Mgst1 Rat Tolmetin glucuronide increases expression ISO MGST1 (Homo sapiens) 6480464 tolmetin glucuronide results in increased expression of MGST1 mRNA CTD PMID:26528891 Mgst1 Rat toluene 2,4-diisocyanate decreases expression ISO Mgst1 (Mus musculus) 6480464 Toluene 2,4-Diisocyanate results in decreased expression of MGST1 mRNA CTD PMID:21404309 Mgst1 Rat trans-caffeic acid increases activity EXP 6480464 caffeic acid results in increased activity of MGST1 protein CTD PMID:16125204 Mgst1 Rat trans-isoeugenol increases expression ISO MGST1 (Homo sapiens) 6480464 isoeugenol results in increased expression of MGST1 mRNA CTD PMID:20566472 Mgst1 Rat Tributyltin oxide increases expression ISO Mgst1 (Mus musculus) 6480464 bis(tri-n-butyltin)oxide results in increased expression of MGST1 mRNA CTD PMID:18958704 Mgst1 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of MGST1 mRNA CTD PMID:33387578 Mgst1 Rat trichostatin A increases expression ISO MGST1 (Homo sapiens) 6480464 trichostatin A results in increased expression of MGST1 mRNA CTD PMID:24935251|PMID:26272509 Mgst1 Rat trichostatin A multiple interactions ISO MGST1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mgst1 Rat triclosan decreases expression ISO MGST1 (Homo sapiens) 6480464 Triclosan results in decreased expression of MGST1 mRNA CTD PMID:30510588 Mgst1 Rat triethylenediamine multiple interactions EXP 6480464 triethylenediamine inhibits the reaction [Gallic Acid results in increased activity of MGST1 protein] CTD PMID:19111564 Mgst1 Rat trimellitic anhydride decreases expression ISO Mgst1 (Mus musculus) 6480464 trimellitic anhydride results in decreased expression of MGST1 mRNA CTD PMID:19042947 Mgst1 Rat triphenyl phosphate affects expression ISO MGST1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of MGST1 mRNA CTD PMID:37042841 Mgst1 Rat triptonide decreases expression ISO Mgst1 (Mus musculus) 6480464 triptonide results in decreased expression of MGST1 mRNA CTD PMID:33045310 Mgst1 Rat triticonazole increases expression EXP 6480464 triticonazole results in increased expression of MGST1 mRNA CTD PMID:36084822 Mgst1 Rat troglitazone increases expression ISO Mgst1 (Mus musculus) 6480464 troglitazone results in increased expression of MGST1 mRNA CTD PMID:28973697 Mgst1 Rat tunicamycin decreases expression ISO Mgst1 (Mus musculus) 6480464 Tunicamycin results in decreased expression of MGST1 mRNA CTD PMID:17127020 Mgst1 Rat urethane decreases expression ISO MGST1 (Homo sapiens) 6480464 Urethane results in decreased expression of MGST1 mRNA CTD PMID:28818685 Mgst1 Rat valproic acid decreases methylation ISO MGST1 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of MGST1 gene CTD PMID:29154799 Mgst1 Rat valproic acid multiple interactions ISO MGST1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mgst1 Rat valproic acid increases expression ISO MGST1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of MGST1 mRNA CTD PMID:26272509 Mgst1 Rat valproic acid affects expression ISO MGST1 (Homo sapiens) 6480464 Valproic Acid affects the expression of MGST1 mRNA CTD PMID:25979313 Mgst1 Rat vinclozolin increases expression EXP 6480464 vinclozolin results in increased expression of MGST1 mRNA CTD PMID:22570695|PMID:22615374 Mgst1 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of MGST1 mRNA CTD PMID:19015723 Mgst1 Rat vorinostat multiple interactions ISO MGST1 (Homo sapiens) 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Mgst1 Rat zileuton decreases activity EXP 6480464 zileuton results in decreased activity of MGST1 protein CTD PMID:9890956 Mgst1 Rat zinc atom decreases expression EXP 6480464 Zinc deficiency results in decreased expression of MGST1 mRNA CTD PMID:11717422 Mgst1 Rat zinc(0) decreases expression EXP 6480464 Zinc deficiency results in decreased expression of MGST1 mRNA CTD PMID:11717422 Mgst1 Rat zoledronic acid decreases expression ISO MGST1 (Homo sapiens) 6480464 zoledronic acid results in decreased expression of MGST1 mRNA CTD PMID:24714768
Imported Annotations - KEGG (archival)
(+)-schisandrin B (EXP) (-)-epigallocatechin 3-gallate (EXP) (E)-cinnamyl alcohol (ISO) (S)-amphetamine (EXP) 1,1'-azobis(N,N-dimethylformamide) (EXP) 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane (ISO) 1,2-dimethylhydrazine (EXP,ISO) 1,4-dithiothreitol (EXP) 1-chloro-2,4-dinitrobenzene (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2,6-dimethoxyphenol (ISO) 2-amino-2-deoxy-D-galactopyranose (EXP) 2-bromohexadecanoic acid (ISO) 2-palmitoylglycerol (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) 8-Br-cAMP (ISO) acetamide (EXP) aconitine (EXP) acrolein (EXP) aflatoxin B1 (ISO) aflatoxin M1 (ISO) all-trans-retinoic acid (EXP,ISO) alpha-hexylcinnamaldehyde (ISO) amiodarone (ISO) ammonium chloride (EXP) antimonite (ISO) Aroclor 1254 (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) atrazine (EXP) Azaspiracid (ISO) Bandrowski's base (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-lapachone (ISO) beta-naphthoflavone (ISO) bis(2-chloroethyl) sulfide (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) bongkrekic acid (EXP) bosentan (ISO) buta-1,3-diene (ISO) Butylbenzyl phthalate (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) carbamazepine (ISO) carbon nanotube (ISO) chenodeoxycholic acid (ISO) chlordecone (ISO) chlorogenic acid (EXP) cinnamyl alcohol (ISO) ciprofibrate (ISO) cis-caffeic acid (EXP) cisplatin (ISO) clofibrate (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) crocidolite asbestos (ISO) cumene hydroperoxide (EXP) curcumin (EXP) cyclophosphamide (EXP) cyclosporin A (EXP,ISO) deoxycholic acid (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) diazinon (EXP) dibutyl phthalate (EXP,ISO) dichlorine (EXP) dichloromethane (ISO) dicyclanil (ISO) diethyl phthalate (ISO) diisobutyl phthalate (ISO) diisononyl phthalate (ISO) dimethylarsinic acid (EXP) dinophysistoxin 1 (ISO) dioxygen (ISO) dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate (ISO) diquat (ISO) disodium selenite (ISO) disulfiram (ISO) dorsomorphin (ISO) doxorubicin (EXP) ellagic acid (EXP) emamectin benzoate (ISO) endosulfan (EXP) ethoxyquin (ISO) eugenol (ISO) ferric oxide (EXP) flutamide (ISO) folic acid (ISO) furan (EXP) furfural (ISO) gallic acid (EXP) genistein (EXP,ISO) gentamycin (EXP) glutathione (EXP) glycochenodeoxycholic acid (ISO) glycocholic acid (ISO) glycodeoxycholic acid (ISO) hemin (EXP) hydrogen peroxide (EXP) hydroquinone (ISO) inulin (ISO) iron trichloride (EXP) isoeugenol (ISO) isoniazide (ISO) isoprenaline (ISO) ivermectin (ISO) ketoconazole (EXP) kojic acid (EXP) L-1,4-dithiothreitol (EXP) L-ascorbic acid (EXP) lead diacetate (EXP,ISO) lead nitrate (ISO) leukotriene A4 (EXP) leukotriene B4 (EXP) leukotriene C4 (EXP) leukotriene D4 (EXP) leukotriene E4 (EXP) lipopolysaccharide (EXP) lutein (ISO) manganese(II) chloride (EXP) medroxyprogesterone acetate (ISO) methimazole (ISO) methoxyacetic acid (EXP) methoxychlor (EXP,ISO) methyl methanesulfonate (ISO) methylmercury chloride (ISO) microcystin (EXP) morin (EXP) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) N-nitrosodiethylamine (EXP) nickel atom (ISO) nickel sulfate (ISO) nitric oxide (EXP) nitrofen (EXP) O-acetyl-L-carnitine (EXP) ochratoxin A (EXP,ISO) ozone (EXP) paracetamol (EXP,ISO) paraquat (EXP,ISO) parathion (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) peroxynitrous acid (EXP) phenobarbital (EXP) PhIP (EXP) phlorizin (ISO) pirinixic acid (ISO) poly(I:C) (ISO) progesterone (EXP,ISO) propiconazole (ISO) protein kinase inhibitor (ISO) pyrimidin-2-amine (EXP) quercetin (EXP) rac-1,2-dichloropropane (ISO) reactive oxygen species (EXP) retinyl acetate (ISO) rotenone (EXP,ISO) S-nitroso-L-cysteine (EXP) S-nitrosoglutathione (EXP) SB 431542 (ISO) serpentine asbestos (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenate (ISO) sodium arsenite (EXP,ISO) sodium chloride (ISO) sodium dichromate (EXP) spironolactone (ISO) sunitinib (ISO) Sunset Yellow FCF (ISO) tamoxifen (ISO) tartrazine (ISO) tetrachloroethene (ISO) tetrachloromethane (EXP,ISO) thioacetamide (EXP,ISO) tolcapone (EXP) Tolmetin glucuronide (ISO) toluene 2,4-diisocyanate (ISO) trans-caffeic acid (EXP) trans-isoeugenol (ISO) Tributyltin oxide (ISO) trichloroethene (EXP) trichostatin A (ISO) triclosan (ISO) triethylenediamine (EXP) trimellitic anhydride (ISO) triphenyl phosphate (ISO) triptonide (ISO) triticonazole (EXP) troglitazone (ISO) tunicamycin (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP) vorinostat (ISO) zileuton (EXP) zinc atom (EXP) zinc(0) (EXP) zoledronic acid (ISO)
1.
DD-RT-PCR identifies 7-dehydrocholesterol reductase as a key marker of early Leydig cell steroidogenesis.
Anbalagan M, etal., Mol Cell Endocrinol. 2004 Apr 30;219(1-2):37-45.
2.
[Rat microsomal glutathione S-transferase 1 alters cytotoxic effects of chlorambucil on PC-3, K562, HepG2 and P388D1 cell lines]
Chen Z, etal., Zhejiang Da Xue Xue Bao Yi Xue Ban. 2007 May;36(3):236-40.
3.
Gene expression of rat and human microsomal glutathione S-transferases.
DeJong JL, etal., J Biol Chem 1988 Jun 15;263(17):8430-6.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
Structural basis for detoxification and oxidative stress protection in membranes.
Holm PJ, etal., J Mol Biol. 2006 Jul 28;360(5):934-45. Epub 2006 Jun 5.
7.
Insights into the membrane proteome of rat liver peroxisomes: microsomal glutathione-S-transferase is shared by both subcellular compartments.
Islinger M, etal., Proteomics. 2006 Feb;6(3):804-16.
8.
Proteomic analysis of rat liver peroxisome: presence of peroxisome-specific isozyme of Lon protease.
Kikuchi M, etal., J Biol Chem. 2004 Jan 2;279(1):421-8. Epub 2003 Oct 15.
9.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
10.
Novel function of glutathione transferase in rat liver mitochondrial membrane: role for cytochrome c release from mitochondria.
Lee KK, etal., Toxicol Appl Pharmacol. 2008 Oct 1;232(1):109-18. Epub 2008 Jun 25.
11.
Observation of an intact noncovalent homotrimer of detergent-solubilized rat microsomal glutathione transferase-1 by electrospray mass spectrometry.
Lengqvist J, etal., J Biol Chem. 2004 Apr 2;279(14):13311-6. Epub 2004 Jan 14.
12.
Gene Data Set
MGD Curation, June 12, 2002
13.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
14.
Microsomal glutathione S-transferase. Purification, initial characterization and demonstration that it is not identical to the cytosolic glutathione S-transferases A, B and C.
Morgenstern R, etal., Eur J Biochem. 1982 Nov;128(1):243-8.
15.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
16.
Purification and properties of glutathione S-transferase from outer mitochondrial membrane of rat liver.
Nishino H and Ito A, Biochem Int. 1990;20(6):1059-66.
17.
Immunolocalization of microsomal glutathione S-transferase in rat tissues.
Otieno MA, etal., Drug Metab Dispos. 1997 Jan;25(1):12-20.
18.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
19.
GOA pipeline
RGD automated data pipeline
20.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
21.
Molecular basis for the dual subcellular distribution of microsomal glutathione transferase 1.
Shimoji M, etal., Biochim Biophys Acta Biomembr. 2017 Feb;1859(2):238-244. doi: 10.1016/j.bbamem.2016.11.014. Epub 2016 Nov 30.
22.
The role of glutathione-S-transferase in anti-cancer drug resistance.
Townsend DM and Tew KD, Oncogene 2003 Oct 20;22(47):7369-75.
Mgst1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 172,760,930 - 172,776,157 (+) NCBI GRCr8 GRCr8 Ensembl 4 172,760,886 - 172,776,875 (+) Ensembl GRCr8 Ensembl mRatBN7.2 4 171,029,666 - 171,044,893 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 171,029,630 - 171,044,892 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 177,324,703 - 177,339,950 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 173,108,869 - 173,124,108 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 171,729,410 - 171,744,649 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 172,119,382 - 172,134,609 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 172,119,331 - 172,134,607 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 236,372,225 - 236,387,452 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 175,248,654 - 175,263,881 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 159,602,240 - 159,617,460 (+) NCBI Celera RGSC_v3.1 4 175,493,783 - 175,509,005 (+) NCBI RH 3.4 Map 4 1032.9 RGD Cytogenetic Map 4 q44 NCBI
MGST1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 16,347,115 - 16,593,331 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 16,347,142 - 16,609,259 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 16,500,049 - 16,530,126 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 16,391,343 - 16,408,611 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 16,391,342 - 16,408,610 NCBI Celera 12 21,643,859 - 21,661,125 (+) NCBI Celera Cytogenetic Map 12 p12.3 NCBI HuRef 12 16,268,374 - 16,298,400 (+) NCBI HuRef CHM1_1 12 16,465,087 - 16,495,133 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 16,224,568 - 16,466,967 (+) NCBI T2T-CHM13v2.0
Mgst1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 138,117,525 - 138,133,753 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 138,117,314 - 138,133,753 (+) Ensembl GRCm39 Ensembl GRCm38 6 138,140,527 - 138,156,755 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 138,140,316 - 138,156,755 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 138,089,058 - 138,105,273 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 138,104,733 - 138,120,948 (+) NCBI MGSCv36 mm8 Celera 6 141,204,105 - 141,221,034 (+) NCBI Celera Cytogenetic Map 6 G1 NCBI cM Map 6 68.4 NCBI
Mgst1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 12,989,935 - 13,007,761 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 12,989,935 - 13,005,203 (+) NCBI ChiLan1.0 ChiLan1.0
MGST1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 21,793,489 - 21,823,123 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 21,790,250 - 21,819,884 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 16,347,737 - 16,383,776 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 16,743,739 - 16,773,290 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 16,743,739 - 16,773,290 (+) Ensembl panpan1.1 panPan2
MGST1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 30,370,588 - 30,391,898 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 30,370,594 - 30,391,778 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 16,055,808 - 16,077,100 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 30,690,546 - 30,712,016 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 30,690,548 - 30,711,952 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 30,541,771 - 30,563,263 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 30,537,988 - 30,559,272 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 15,775,516 - 15,796,781 (+) NCBI UU_Cfam_GSD_1.0
Mgst1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 91,542,405 - 91,559,526 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936587 1,269,184 - 1,287,150 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936587 1,270,030 - 1,287,130 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MGST1
MGST1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 16,270,588 - 16,300,446 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 16,277,434 - 16,287,171 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666069 19,006,137 - 19,023,047 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mgst1
.
Predicted Target Of
Count of predictions: 205 Count of miRNA genes: 147 Interacting mature miRNAs: 155 Transcripts: ENSRNOT00000010579 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 1300109 Rf13 Renal function QTL 13 3.91 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 4 157710145 182687754 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat
RH142292
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 171,044,542 - 171,044,729 (+) MAPPER mRatBN7.2 Rnor_6.0 4 172,134,259 - 172,134,445 NCBI Rnor6.0 Rnor_5.0 4 236,387,102 - 236,387,288 UniSTS Rnor5.0 RGSC_v3.4 4 175,263,531 - 175,263,717 UniSTS RGSC3.4 Celera 4 159,617,110 - 159,617,296 UniSTS RH 3.4 Map 4 1032.9 UniSTS Cytogenetic Map 4 q44 UniSTS
BI277057
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 171,044,355 - 171,044,564 (+) MAPPER mRatBN7.2 Rnor_6.0 4 172,134,072 - 172,134,280 NCBI Rnor6.0 Rnor_5.0 4 236,386,915 - 236,387,123 UniSTS Rnor5.0 RGSC_v3.4 4 175,263,344 - 175,263,552 UniSTS RGSC3.4 Celera 4 159,616,923 - 159,617,131 UniSTS RH 3.4 Map 4 1045.0 UniSTS Cytogenetic Map 4 q44 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000010579 ⟹ ENSRNOP00000010579
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 Ensembl 4 172,760,886 - 172,776,875 (+) Ensembl mRatBN7.2 Ensembl 4 171,029,630 - 171,044,892 (+) Ensembl Rnor_6.0 Ensembl 4 172,119,331 - 172,134,607 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000110483 ⟹ ENSRNOP00000094357
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 Ensembl 4 172,760,886 - 172,772,354 (+) Ensembl mRatBN7.2 Ensembl 4 171,029,630 - 171,041,090 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000110698 ⟹ ENSRNOP00000091759
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 Ensembl 4 172,762,050 - 172,776,875 (+) Ensembl mRatBN7.2 Ensembl 4 171,030,786 - 171,044,892 (+) Ensembl
RefSeq Acc Id:
NM_134349 ⟹ NP_599176
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 172,760,930 - 172,776,157 (+) NCBI mRatBN7.2 4 171,029,666 - 171,044,893 (+) NCBI Rnor_6.0 4 172,119,382 - 172,134,609 (+) NCBI Rnor_5.0 4 236,372,225 - 236,387,452 (+) NCBI RGSC_v3.4 4 175,248,654 - 175,263,881 (+) RGD Celera 4 159,602,240 - 159,617,460 (+) RGD
Sequence:
CTCCGCAGGACAGCTAGCAGCGCTTCCTCCTGGGATTCAGTCATTTAAAGATTGAGACCAAGATTGAAAGCATGGCTGACCTCAAGCAGCTCATGGACAACGAGGTGTTGATGGCCTTTACCTCCTAT
hide sequence
RefSeq Acc Id:
NP_599176 ⟸ NM_134349
- UniProtKB:
P08011 (UniProtKB/Swiss-Prot), B6DYQ4 (UniProtKB/TrEMBL)
- Sequence:
MADLKQLMDNEVLMAFTSYATIILAKMMFLSSATAFQRLTNKVFANPEDCAGFGKGENAKKFLRTDEKVERVRRAHLNDLENIVPFLGIGLLYSLSGPDLSTALIHFRIFVGARIYHTIAYLTPLPQP
hide sequence
Ensembl Acc Id:
ENSRNOP00000010579 ⟸ ENSRNOT00000010579
Ensembl Acc Id:
ENSRNOP00000094357 ⟸ ENSRNOT00000110483
Ensembl Acc Id:
ENSRNOP00000091759 ⟸ ENSRNOT00000110698
RGD ID: 13693474 Promoter ID: EPDNEW_R3997 Type: initiation region Name: Mgst1_1 Description: microsomal glutathione S-transferase 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 172,119,388 - 172,119,448 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2002-07-09
Mgst1
microsomal glutathione S-transferase 1
Symbol and Name updated to reflect Human and Mouse nomenclature
70877 APPROVED
Note Type
Note
Reference
gene_protein
154 amino acids
70791
