Symbol:
Itpr2
Name:
inositol 1,4,5-trisphosphate receptor, type 2
RGD ID:
69649
Description:
Enables calcium ion binding activity; inositol 1,4,5 trisphosphate binding activity; and inositol 1,4,5-trisphosphate-gated calcium channel activity. Involved in cellular response to hypoxia and release of sequestered calcium ion into cytosol. Located in axon; endoplasmic reticulum membrane; and sarcoplasmic reticulum. Human ortholog(s) of this gene implicated in amyotrophic lateral sclerosis and isolated anhidrosis with normal sweat glands. Orthologous to human ITPR2 (inositol 1,4,5-trisphosphate receptor type 2); PARTICIPATES IN calcium transport pathway; calcium/calcium-mediated signaling pathway; Alzheimer's disease pathway; INTERACTS WITH 2,4,6-trinitrobenzenesulfonic acid; 2,6-dinitrotoluene; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
inositol 1,4,5-triphosphate receptor 2; inositol 1,4,5-triphosphate receptor type 2; inositol 1,4,5-triphosphate receptor, type 2; inositol 1,4,5-trisphosphate receptor type 2; inositol 1,4,5-trisphosphate-gated calcium channel ITPR2; inositol 145-triphosphate receptor type 2; inositol triphosphate receptor type 2; insP3R2; IP3 receptor; IP3R 2; LOC102553163; type 2 inositol 1,4,5-trisphosphate receptor; type 2 InsP3 receptor; uncharacterized LOC102553163
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2) HGNC
HomoloGene, NCBI, Panther
Mus musculus (house mouse):
Itpr2 (inositol 1,4,5-triphosphate receptor 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Itpr2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Itpr2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Itpr2 (inositol 1,4,5-trisphosphate receptor type 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
ERMARD (ER membrane associated RNA degradation) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
ITPR2 (inositol 1,4,5-trisphosphate receptor type 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Itpr2 (inositol 1,4,5-triphosphate receptor 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
itpr2 (inositol 1,4,5-trisphosphate receptor, type 2)
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Caenorhabditis elegans (roundworm):
itr-1
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Itp-r83A
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
itpr2
Alliance
DIOPT (OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 180,759,325 - 181,165,361 (-) NCBI GRCr8 mRatBN7.2 4 179,028,594 - 179,434,657 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 179,027,281 - 179,404,164 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 185,313,424 - 185,690,245 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 181,097,944 - 181,474,767 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 179,718,376 - 180,095,194 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 180,423,452 - 180,800,088 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 180,538,389 - 180,722,358 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 244,585,711 - 244,960,429 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 183,677,606 - 184,066,130 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 183,922,730 - 184,311,254 (-) NCBI Celera 4 167,526,971 - 167,901,481 (-) NCBI Celera RH 3.4 Map 4 1070.3 RGD Cytogenetic Map 4 q44 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Itpr2 Rat (-)-epigallocatechin 3-gallate increases expression ISO ITPR2 (Homo sapiens) 6480464 epigallocatechin gallate results in increased expression of ITPR2 mRNA CTD PMID:22079256 Itpr2 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of ITPR2 mRNA CTD PMID:22079256 Itpr2 Rat (1->4)-beta-D-glucan multiple interactions ISO Itpr2 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of ITPR2 mRNA CTD PMID:36331819 Itpr2 Rat 1,1-dichloroethene decreases expression ISO Itpr2 (Mus musculus) 6480464 vinylidene chloride results in decreased expression of ITPR2 mRNA CTD PMID:26682919 Itpr2 Rat 1,2-dichloroethane increases expression ISO Itpr2 (Mus musculus) 6480464 ethylene dichloride results in increased expression of ITPR2 mRNA CTD PMID:28960355 Itpr2 Rat 1,2-dimethylhydrazine decreases expression ISO Itpr2 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of ITPR2 mRNA CTD PMID:22206623 Itpr2 Rat 1,2-dimethylhydrazine multiple interactions ISO Itpr2 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in decreased expression of ITPR2 mRNA] CTD PMID:22206623 Itpr2 Rat 17beta-estradiol decreases expression ISO Itpr2 (Mus musculus) 6480464 Estradiol results in decreased expression of ITPR2 mRNA CTD PMID:39298647 Itpr2 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Itpr2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to ITPR2 gene] CTD PMID:20819909 Itpr2 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Itpr2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ITPR2 mRNA CTD PMID:26290441 Itpr2 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO ITPR2 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ITPR2 mRNA CTD PMID:20106945 and PMID:21632981 Itpr2 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Itpr2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of ITPR2 mRNA CTD PMID:21570461 Itpr2 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Itpr2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of ITPR2 mRNA CTD PMID:17035482 and PMID:20819909 Itpr2 Rat 2,4,6-trinitrobenzenesulfonic acid increases expression EXP 6480464 Trinitrobenzenesulfonic Acid results in increased expression of ITPR2 mRNA CTD PMID:23537331 Itpr2 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of ITPR2 mRNA CTD PMID:21346803 Itpr2 Rat 2-butoxyethanol decreases expression ISO Itpr2 (Mus musculus) 6480464 n-butoxyethanol results in decreased expression of ITPR2 mRNA CTD PMID:19812364 Itpr2 Rat 2-hydroxypropanoic acid increases expression ISO ITPR2 (Homo sapiens) 6480464 Lactic Acid results in increased expression of ITPR2 mRNA CTD PMID:30851411 Itpr2 Rat 4,4'-sulfonyldiphenol increases expression ISO Itpr2 (Mus musculus) 6480464 bisphenol S results in increased expression of ITPR2 mRNA CTD PMID:30951980 Itpr2 Rat 4,4'-sulfonyldiphenol affects methylation ISO Itpr2 (Mus musculus) 6480464 bisphenol S affects the methylation of ITPR2 gene CTD PMID:31683443 Itpr2 Rat 4,4'-sulfonyldiphenol decreases expression ISO Itpr2 (Mus musculus) 6480464 bisphenol S results in decreased expression of ITPR2 mRNA CTD PMID:39298647 Itpr2 Rat 4-hydroxyphenyl retinamide increases expression ISO Itpr2 (Mus musculus) 6480464 Fenretinide results in increased expression of ITPR2 mRNA CTD PMID:28973697 Itpr2 Rat 4-nitrophenol increases expression ISO Itpr2 (Mus musculus) 6480464 4-nitrophenol results in increased expression of ITPR2 mRNA CTD PMID:34673133 Itpr2 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of ITPR2 mRNA CTD PMID:24780913 Itpr2 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of ITPR2 mRNA CTD PMID:31881176 Itpr2 Rat acetazolamide increases expression ISO Itpr2 (Mus musculus) 6480464 Acetazolamide results in increased expression of ITPR2 mRNA CTD PMID:19274763 Itpr2 Rat Adenophostin A multiple interactions ISO Itpr2 (Mus musculus) 6480464 2-aminoethoxydiphenyl borate inhibits the reaction [[adenophostin A results in increased activity of ITPR2 protein] which results in increased transport of Calcium] more ... CTD PMID:15201137 Itpr2 Rat Adenophostin A increases activity ISO Itpr2 (Mus musculus) 6480464 adenophostin A results in increased activity of ITPR2 protein CTD PMID:15201137 Itpr2 Rat aflatoxin B1 increases expression ISO Itpr2 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of ITPR2 mRNA CTD PMID:19770486 Itpr2 Rat aflatoxin B1 decreases methylation ISO ITPR2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of ITPR2 gene CTD PMID:27153756 Itpr2 Rat aflatoxin B1 decreases expression ISO ITPR2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of ITPR2 mRNA CTD PMID:22100608 Itpr2 Rat Aflatoxin B2 alpha increases methylation ISO ITPR2 (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of ITPR2 intron CTD PMID:30157460 Itpr2 Rat aflatoxin M1 decreases expression ISO ITPR2 (Homo sapiens) 6480464 Aflatoxin M1 results in decreased expression of ITPR2 mRNA CTD PMID:30928695 Itpr2 Rat all-trans-retinoic acid affects expression ISO ITPR2 (Homo sapiens) 6480464 Tretinoin affects the expression of ITPR2 mRNA CTD PMID:15498508 Itpr2 Rat all-trans-retinoic acid increases expression ISO ITPR2 (Homo sapiens) 6480464 Tretinoin results in increased expression of ITPR2 mRNA and Tretinoin results in increased expression of ITPR2 protein CTD PMID:15894607 more ... Itpr2 Rat antimony trichloride multiple interactions ISO Itpr2 (Mus musculus) 6480464 antimony trichloride promotes the reaction [Arsenic Trioxide results in increased expression of ITPR2 mRNA] and Arsenic Trioxide promotes the reaction [antimony trichloride results in increased expression of ITPR2 mRNA] CTD PMID:34091186 Itpr2 Rat antimony trichloride increases expression ISO Itpr2 (Mus musculus) 6480464 antimony trichloride results in increased expression of ITPR2 mRNA CTD PMID:34091186 Itpr2 Rat antimycin A decreases expression ISO ITPR2 (Homo sapiens) 6480464 Antimycin A results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat antirheumatic drug decreases expression ISO ITPR2 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of ITPR2 mRNA CTD PMID:24449571 Itpr2 Rat aristolochic acid A decreases expression ISO ITPR2 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of ITPR2 mRNA CTD PMID:33212167 Itpr2 Rat arsane affects methylation ISO ITPR2 (Homo sapiens) 6480464 Arsenic affects the methylation of ITPR2 gene CTD PMID:25304211 Itpr2 Rat arsenic atom affects methylation ISO ITPR2 (Homo sapiens) 6480464 Arsenic affects the methylation of ITPR2 gene CTD PMID:25304211 Itpr2 Rat arsenous acid multiple interactions ISO Itpr2 (Mus musculus) 6480464 antimony trichloride promotes the reaction [Arsenic Trioxide results in increased expression of ITPR2 mRNA] more ... CTD PMID:29095437 and PMID:34091186 Itpr2 Rat arsenous acid increases expression ISO Itpr2 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of ITPR2 mRNA CTD PMID:34091186 Itpr2 Rat arsenous acid increases expression ISO ITPR2 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of ITPR2 protein CTD PMID:30093655 Itpr2 Rat arsenous acid decreases expression ISO Itpr2 (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of ITPR2 mRNA CTD PMID:29095437 Itpr2 Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of ITPR2 gene CTD PMID:35440735 Itpr2 Rat benzo[a]pyrene multiple interactions ISO Itpr2 (Mus musculus) 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to ITPR2 promoter] CTD PMID:19654925 Itpr2 Rat benzo[a]pyrene affects methylation ISO ITPR2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of ITPR2 intron and Benzo(a)pyrene affects the methylation of ITPR2 promoter CTD PMID:27901495 and PMID:30157460 Itpr2 Rat benzo[a]pyrene increases methylation ISO Itpr2 (Mus musculus) 6480464 Benzo(a)pyrene results in increased methylation of ITPR2 exon and Benzo(a)pyrene results in increased methylation of ITPR2 intron CTD PMID:27901495 Itpr2 Rat benzo[a]pyrene decreases methylation ISO ITPR2 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of ITPR2 3' UTR CTD PMID:27901495 Itpr2 Rat benzo[a]pyrene decreases expression ISO ITPR2 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of ITPR2 mRNA and Benzo(a)pyrene results in decreased expression of ITPR2 protein CTD PMID:20064835 more ... Itpr2 Rat benzo[a]pyrene decreases expression ISO Itpr2 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of ITPR2 mRNA CTD PMID:19770486 and PMID:21715664 Itpr2 Rat benzo[e]pyrene decreases methylation ISO ITPR2 (Homo sapiens) 6480464 benzo(e)pyrene results in decreased methylation of ITPR2 intron CTD PMID:30157460 Itpr2 Rat beta-lapachone decreases expression ISO ITPR2 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of ITPR2 mRNA CTD PMID:38218311 Itpr2 Rat bis(2-chloroethyl) sulfide decreases expression ISO Itpr2 (Mus musculus) 6480464 Mustard Gas results in decreased expression of ITPR2 mRNA CTD PMID:15674843 Itpr2 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of ITPR2 gene CTD PMID:33872906 Itpr2 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Itpr2 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of ITPR2 mRNA CTD PMID:33754040 and PMID:34319233 Itpr2 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ITPR2 mRNA CTD PMID:30816183 more ... Itpr2 Rat bisphenol A multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of ITPR2 gene CTD PMID:31601247 Itpr2 Rat bisphenol A increases expression ISO Itpr2 (Mus musculus) 6480464 bisphenol A results in increased expression of ITPR2 mRNA CTD PMID:35598803 Itpr2 Rat bisphenol AF increases expression ISO ITPR2 (Homo sapiens) 6480464 bisphenol AF results in increased expression of ITPR2 protein CTD PMID:34186270 Itpr2 Rat butanal decreases expression ISO ITPR2 (Homo sapiens) 6480464 butyraldehyde results in decreased expression of ITPR2 mRNA CTD PMID:26079696 Itpr2 Rat cadmium atom multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ITPR2 mRNA CTD PMID:35301059 Itpr2 Rat cadmium atom multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of ITPR2 mRNA CTD PMID:37325564 Itpr2 Rat cadmium dichloride multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of ITPR2 mRNA CTD PMID:35301059 Itpr2 Rat cadmium dichloride multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of ITPR2 mRNA CTD PMID:37325564 Itpr2 Rat calcium atom multiple interactions ISO Itpr2 (Mus musculus) 6480464 2-aminoethoxydiphenyl borate inhibits the reaction [[adenophostin A results in increased activity of ITPR2 protein] which results in increased transport of Calcium] more ... CTD PMID:15201137 Itpr2 Rat calcium oxalate multiple interactions EXP 6480464 Losartan inhibits the reaction [Calcium Oxalate results in increased expression of ITPR2 protein] CTD PMID:37454925 Itpr2 Rat calcium oxalate increases expression EXP 6480464 Calcium Oxalate results in increased expression of ITPR2 protein CTD PMID:37454925 Itpr2 Rat calcium(0) multiple interactions ISO Itpr2 (Mus musculus) 6480464 2-aminoethoxydiphenyl borate inhibits the reaction [[adenophostin A results in increased activity of ITPR2 protein] which results in increased transport of Calcium] more ... CTD PMID:15201137 Itpr2 Rat carbamazepine affects expression ISO ITPR2 (Homo sapiens) 6480464 Carbamazepine affects the expression of ITPR2 mRNA CTD PMID:25979313 Itpr2 Rat carbon nanotube decreases expression ISO Itpr2 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Itpr2 Rat CGP 52608 multiple interactions ISO ITPR2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to ITPR2 gene] CTD PMID:28238834 Itpr2 Rat chromium(6+) decreases expression ISO ITPR2 (Homo sapiens) 6480464 chromium hexavalent ion results in decreased expression of ITPR2 mRNA CTD PMID:30690063 Itpr2 Rat chrysene increases expression ISO Itpr2 (Mus musculus) 6480464 chrysene results in increased expression of ITPR2 mRNA CTD PMID:26377693 Itpr2 Rat cisplatin multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of ITPR2 mRNA CTD PMID:27392435 Itpr2 Rat cisplatin decreases expression ISO ITPR2 (Homo sapiens) 6480464 Cisplatin results in decreased expression of ITPR2 mRNA CTD PMID:27392435 and PMID:27594783 Itpr2 Rat cobalt dichloride decreases expression ISO ITPR2 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of ITPR2 mRNA CTD PMID:19320972 Itpr2 Rat copper atom multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of ITPR2 mRNA CTD PMID:30911355 Itpr2 Rat copper(0) multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of ITPR2 mRNA CTD PMID:30911355 Itpr2 Rat copper(II) sulfate decreases expression ISO ITPR2 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of ITPR2 mRNA CTD PMID:19549813 Itpr2 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of ITPR2 mRNA CTD PMID:27523638 Itpr2 Rat cyclosporin A decreases expression ISO ITPR2 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of ITPR2 mRNA CTD PMID:20106945 and PMID:25562108 Itpr2 Rat deguelin decreases expression ISO ITPR2 (Homo sapiens) 6480464 deguelin results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat diarsenic trioxide multiple interactions ISO Itpr2 (Mus musculus) 6480464 antimony trichloride promotes the reaction [Arsenic Trioxide results in increased expression of ITPR2 mRNA] more ... CTD PMID:29095437 and PMID:34091186 Itpr2 Rat diarsenic trioxide increases expression ISO Itpr2 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of ITPR2 mRNA CTD PMID:34091186 Itpr2 Rat diarsenic trioxide decreases expression ISO Itpr2 (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of ITPR2 mRNA CTD PMID:29095437 Itpr2 Rat diarsenic trioxide increases expression ISO ITPR2 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of ITPR2 protein CTD PMID:30093655 Itpr2 Rat diazinon increases methylation ISO ITPR2 (Homo sapiens) 6480464 Diazinon results in increased methylation of ITPR2 gene CTD PMID:22964155 Itpr2 Rat Dibutyl phosphate affects expression ISO ITPR2 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of ITPR2 mRNA CTD PMID:37042841 Itpr2 Rat diuron decreases expression ISO ITPR2 (Homo sapiens) 6480464 Diuron results in decreased expression of ITPR2 mRNA CTD PMID:35967413 Itpr2 Rat dorsomorphin multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Itpr2 Rat epoxiconazole decreases expression ISO Itpr2 (Mus musculus) 6480464 epoxiconazole results in decreased expression of ITPR2 mRNA CTD PMID:35436446 Itpr2 Rat ethanol increases expression ISO Itpr2 (Mus musculus) 6480464 Ethanol results in increased expression of ITPR2 mRNA CTD PMID:30319688 Itpr2 Rat ethanol affects splicing ISO Itpr2 (Mus musculus) 6480464 Ethanol affects the splicing of ITPR2 mRNA CTD PMID:30319688 Itpr2 Rat fenpyroximate decreases expression ISO ITPR2 (Homo sapiens) 6480464 fenpyroximate results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat fenthion decreases expression ISO Itpr2 (Mus musculus) 6480464 Fenthion results in decreased expression of ITPR2 mRNA CTD PMID:34813904 Itpr2 Rat folic acid multiple interactions ISO Itpr2 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in decreased expression of ITPR2 mRNA] CTD PMID:22206623 Itpr2 Rat formaldehyde decreases expression ISO ITPR2 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of ITPR2 mRNA CTD PMID:23649840 Itpr2 Rat fulvestrant increases methylation ISO ITPR2 (Homo sapiens) 6480464 Fulvestrant results in increased methylation of ITPR2 gene CTD PMID:31601247 Itpr2 Rat fulvestrant multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of ITPR2 gene CTD PMID:31601247 Itpr2 Rat glyoxylic acid increases expression EXP 6480464 glyoxylic acid results in increased expression of ITPR2 protein CTD PMID:37454925 Itpr2 Rat lead(0) increases expression EXP 6480464 Lead results in increased expression of ITPR2 mRNA and Lead results in increased expression of ITPR2 protein CTD PMID:25921245 Itpr2 Rat losartan multiple interactions EXP 6480464 Losartan inhibits the reaction [Calcium Oxalate results in increased expression of ITPR2 protein] CTD PMID:37454925 Itpr2 Rat mercury dibromide increases expression ISO ITPR2 (Homo sapiens) 6480464 mercuric bromide results in increased expression of ITPR2 mRNA CTD PMID:26272509 Itpr2 Rat mercury dibromide multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat metformin multiple interactions ISO Itpr2 (Mus musculus) 6480464 Metformin inhibits the reaction [Arsenic Trioxide results in decreased expression of ITPR2 mRNA] CTD PMID:29095437 Itpr2 Rat methamphetamine increases expression ISO Itpr2 (Mus musculus) 6480464 Methamphetamine results in increased expression of ITPR2 mRNA CTD PMID:26307267 Itpr2 Rat methapyrilene decreases methylation ISO ITPR2 (Homo sapiens) 6480464 Methapyrilene results in decreased methylation of ITPR2 intron CTD PMID:30157460 Itpr2 Rat methidathion decreases expression ISO Itpr2 (Mus musculus) 6480464 methidathion results in decreased expression of ITPR2 mRNA CTD PMID:34813904 Itpr2 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of ITPR2 gene CTD PMID:35440735 Itpr2 Rat methyl methanesulfonate decreases expression ISO ITPR2 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of ITPR2 mRNA CTD PMID:23649840 Itpr2 Rat methylphenidate increases expression EXP 6480464 Methylphenidate results in increased expression of ITPR2 mRNA CTD PMID:17105903 Itpr2 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of ITPR2 gene CTD PMID:33872906 Itpr2 Rat N-hexadecanoylsphingosine increases expression ISO Itpr2 (Mus musculus) 6480464 N-palmitoylsphingosine results in increased expression of ITPR2 mRNA CTD PMID:28223344 Itpr2 Rat N-hexadecanoylsphingosine multiple interactions ISO Itpr2 (Mus musculus) 6480464 [N-palmitoylsphingosine co-treated with Dietary Fats] results in increased expression of ITPR2 mRNA more ... CTD PMID:28223344 Itpr2 Rat nitrates multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of ITPR2 mRNA CTD PMID:35964746 Itpr2 Rat Nor-9-carboxy-delta9-THC multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of ITPR2 gene CTD PMID:30521419 Itpr2 Rat ozone decreases expression ISO Itpr2 (Mus musculus) 6480464 Ozone results in decreased expression of ITPR2 mRNA CTD PMID:12763052 Itpr2 Rat ozone multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of ITPR2 mRNA and [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of ITPR2 mRNA CTD PMID:34911549 Itpr2 Rat panobinostat multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat panobinostat increases expression ISO ITPR2 (Homo sapiens) 6480464 panobinostat results in increased expression of ITPR2 mRNA CTD PMID:26272509 Itpr2 Rat paracetamol affects expression ISO Itpr2 (Mus musculus) 6480464 Acetaminophen affects the expression of ITPR2 mRNA CTD PMID:17562736 Itpr2 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of ITPR2 mRNA CTD PMID:33387578 Itpr2 Rat paracetamol decreases expression ISO ITPR2 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of ITPR2 mRNA CTD PMID:21420995 Itpr2 Rat pentanal decreases expression ISO ITPR2 (Homo sapiens) 6480464 pentanal results in decreased expression of ITPR2 mRNA CTD PMID:26079696 Itpr2 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Itpr2 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of ITPR2 mRNA CTD PMID:36331819 Itpr2 Rat phenethyl caffeate multiple interactions ISO Itpr2 (Mus musculus) 6480464 [caffeic acid phenethyl ester co-treated with Dietary Fats] results in decreased expression of ITPR2 mRNA and NR1H4 protein affects the reaction [[caffeic acid phenethyl ester co-treated with Dietary Fats] results in decreased expression of ITPR2 mRNA] CTD PMID:28223344 Itpr2 Rat phenylephrine increases activity ISO Itpr2 (Mus musculus) 6480464 Phenylephrine results in increased activity of ITPR2 protein CTD PMID:15201137 Itpr2 Rat phenylephrine multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Phenylephrine results in increased activity of ITPR2 protein] which results in increased expression of ACTA1 mRNA and [Phenylephrine results in increased activity of ITPR2 protein] which results in increased expression of NPPA mRNA CTD PMID:15201137 Itpr2 Rat phenylmercury acetate increases expression ISO ITPR2 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of ITPR2 mRNA CTD PMID:26272509 Itpr2 Rat phenylmercury acetate multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat picoxystrobin decreases expression ISO ITPR2 (Homo sapiens) 6480464 picoxystrobin results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat potassium chromate multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of ITPR2 mRNA CTD PMID:22079256 Itpr2 Rat potassium chromate decreases expression ISO ITPR2 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of ITPR2 mRNA CTD PMID:22079256 and PMID:22714537 Itpr2 Rat propiconazole decreases expression EXP 6480464 propiconazole results in decreased expression of ITPR2 mRNA CTD PMID:19423681 Itpr2 Rat quercetin decreases expression ISO ITPR2 (Homo sapiens) 6480464 Quercetin results in decreased expression of ITPR2 mRNA CTD PMID:21632981 Itpr2 Rat rac-lactic acid increases expression ISO ITPR2 (Homo sapiens) 6480464 Lactic Acid results in increased expression of ITPR2 mRNA CTD PMID:30851411 Itpr2 Rat resveratrol multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of ITPR2 mRNA CTD PMID:23557933 Itpr2 Rat rimonabant multiple interactions ISO Itpr2 (Mus musculus) 6480464 Rimonabant inhibits the reaction [Dietary Fats results in increased expression of ITPR2 mRNA] CTD PMID:19030233 Itpr2 Rat rotenone decreases expression ISO ITPR2 (Homo sapiens) 6480464 Rotenone results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat SB 431542 multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Itpr2 Rat sodium arsenite decreases expression ISO ITPR2 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of ITPR2 mRNA CTD PMID:29301061 Itpr2 Rat sodium dichromate decreases expression ISO ITPR2 (Homo sapiens) 6480464 sodium bichromate results in decreased expression of ITPR2 mRNA CTD PMID:17685462 Itpr2 Rat sodium dichromate decreases expression EXP 6480464 sodium bichromate results in decreased expression of ITPR2 mRNA CTD PMID:25993096 Itpr2 Rat sodium fluoride increases expression ISO Itpr2 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of ITPR2 protein CTD PMID:28918527 Itpr2 Rat succimer multiple interactions ISO Itpr2 (Mus musculus) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of ITPR2 mRNA CTD PMID:26378955 Itpr2 Rat tamibarotene affects expression ISO ITPR2 (Homo sapiens) 6480464 tamibarotene affects the expression of ITPR2 mRNA CTD PMID:15498508 Itpr2 Rat tauroursodeoxycholic acid multiple interactions ISO Itpr2 (Mus musculus) 6480464 ursodoxicoltaurine inhibits the reaction [[N-palmitoylsphingosine co-treated with Dietary Fats] results in increased expression of ITPR2 mRNA] and ursodoxicoltaurine inhibits the reaction [N-palmitoylsphingosine results in increased expression of ITPR2 mRNA] CTD PMID:28223344 Itpr2 Rat tebufenpyrad decreases expression ISO ITPR2 (Homo sapiens) 6480464 4-chloro-N-((4-(1 and 1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat thapsigargin increases expression ISO Itpr2 (Mus musculus) 6480464 Thapsigargin results in increased expression of ITPR2 mRNA CTD PMID:28223344 Itpr2 Rat thifluzamide decreases expression ISO ITPR2 (Homo sapiens) 6480464 thifluzamide results in decreased expression of ITPR2 mRNA CTD PMID:33512557 Itpr2 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of ITPR2 mRNA CTD PMID:23411599 and PMID:34492290 Itpr2 Rat torcetrapib increases expression ISO ITPR2 (Homo sapiens) 6480464 torcetrapib results in increased expression of ITPR2 mRNA CTD PMID:23228038 Itpr2 Rat trichostatin A increases expression ISO ITPR2 (Homo sapiens) 6480464 trichostatin A results in increased expression of ITPR2 mRNA CTD PMID:24935251 and PMID:26272509 Itpr2 Rat trichostatin A multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat triclosan increases expression ISO ITPR2 (Homo sapiens) 6480464 Triclosan results in increased expression of ITPR2 mRNA CTD PMID:30510588 Itpr2 Rat triphenyl phosphate affects expression ISO ITPR2 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of ITPR2 mRNA CTD PMID:37042841 Itpr2 Rat trovafloxacin decreases expression ISO Itpr2 (Mus musculus) 6480464 trovafloxacin results in decreased expression of ITPR2 mRNA CTD PMID:35537566 Itpr2 Rat tungsten decreases expression ISO Itpr2 (Mus musculus) 6480464 Tungsten results in decreased expression of ITPR2 mRNA CTD PMID:30912803 Itpr2 Rat valproic acid decreases expression ISO ITPR2 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of ITPR2 mRNA CTD PMID:29154799 Itpr2 Rat valproic acid affects splicing EXP 6480464 Valproic Acid affects the splicing of ITPR2 mRNA CTD PMID:29427782 Itpr2 Rat valproic acid multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat valproic acid increases expression ISO ITPR2 (Homo sapiens) 6480464 Valproic Acid results in increased expression of ITPR2 mRNA CTD PMID:23179753 more ... Itpr2 Rat valproic acid decreases methylation ISO ITPR2 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of ITPR2 gene CTD PMID:29154799 Itpr2 Rat vancomycin increases expression ISO Itpr2 (Mus musculus) 6480464 Vancomycin results in increased expression of ITPR2 mRNA CTD PMID:18930951 Itpr2 Rat vorinostat multiple interactions ISO ITPR2 (Homo sapiens) 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of ITPR2 mRNA CTD PMID:27188386 Itpr2 Rat xestospongin C multiple interactions ISO Itpr2 (Mus musculus) 6480464 xestospongin C inhibits the reaction [[adenophostin A results in increased activity of ITPR2 protein] which results in increased transport of Calcium] CTD PMID:15201137
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Itpr2 Rat ATP binding enables IEA UniProtKB-KW:KW-0067 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Itpr2 Rat calcium channel activity enables IEA UniProtKB-KW:KW-0107 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Itpr2 Rat calcium channel activity enables IEA InterPro:IPR000699 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Itpr2 Rat calcium ion binding IDA 7175277 RGD Itpr2 Rat calcium ion binding enables IBA PANTHER:PTN001010185 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Itpr2 Rat inositol 1,4,5 trisphosphate binding IDA 7175277 RGD Itpr2 Rat inositol 1,4,5 trisphosphate binding enables IBA MGI:96623 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Itpr2 Rat inositol 1,4,5 trisphosphate binding enables IEA InterPro:IPR000493 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Itpr2 Rat inositol 1,4,5 trisphosphate binding enables IEA UniRule:UR001527769 1600115 GO_REF:0000104 UniProt GO_REF:0000104 Itpr2 Rat inositol 1,4,5 trisphosphate binding IDA 7175267 RGD Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity IDA 7175277 RGD Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IEA UniRule:UR001527769 1600115 GO_REF:0000104 UniProt GO_REF:0000104 Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables ISO Itpr2 (Mus musculus) 1624291 PMID:15632133 more ... RGD PMID:15632133 more ... Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IEA InterPro:IPR000493 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IEA ARBA:ARBA00026498 1600115 GO_REF:0000117 UniProt GO_REF:0000117 Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IBA FB:FBgn0010051 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IMP 12790654 PMID:23166348 BHF-UCL Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IDA 405650256 PMID:22547632 UniProt Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IDA 405650274 PMID:10620513 UniProt Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity enables IDA 405650333 PMID:23019322 UniProt Itpr2 Rat inositol 1,4,5-trisphosphate-gated calcium channel activity IDA 7175271 RGD Itpr2 Rat intracellularly gated calcium channel activity enables ISO Itpr2 (Mus musculus) 1624291 PMID:8063813 RGD PMID:8063813 Itpr2 Rat metal ion binding enables IEA UniProtKB-KW:KW-0479 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Itpr2 Rat monoatomic ion channel activity enables IEA InterPro:IPR005821 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Itpr2 Rat nucleotide binding enables IEA UniProtKB-KW:KW-0547 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Itpr2 Rat phosphatidylinositol binding enables IBA MGI:96623 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Itpr2 Rat phosphatidylinositol binding enables ISO Itpr2 (Mus musculus) 1624291 PMID:17327232 and PMID:8063813 RGD PMID:17327232 and PMID:8063813 Itpr2 Rat protein binding enables IPI UniProtKB:O35425 11535097 PMID:23884412 UniProt Itpr2 Rat protein binding enables ISO Itpr2 (Mus musculus) 1624291 UniProtKB:P61264 and PMID:21424589 RGD PMID:21424589 Itpr2 Rat scaffold protein binding enables ISO ITPR2 (Homo sapiens) 1624291 UniProtKB:Q8NDB2 and PMID:11782428 RGD PMID:11782428 Itpr2 Rat transmembrane transporter binding enables ISO ITPR2 (Homo sapiens) 1624291 UniProtKB:P48995 and PMID:18068335 RGD PMID:18068335
Imported Annotations - KEGG (archival)
(-)-epigallocatechin 3-gallate (ISO) (1->4)-beta-D-glucan (ISO) 1,1-dichloroethene (ISO) 1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4,6-trinitrobenzenesulfonic acid (EXP) 2,6-dinitrotoluene (EXP) 2-butoxyethanol (ISO) 2-hydroxypropanoic acid (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 4-nitrophenol (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) acetazolamide (ISO) Adenophostin A (ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) aflatoxin M1 (ISO) all-trans-retinoic acid (ISO) antimony trichloride (ISO) antimycin A (ISO) antirheumatic drug (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) atrazine (EXP) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) beta-lapachone (ISO) bis(2-chloroethyl) sulfide (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) butanal (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcium atom (ISO) calcium oxalate (EXP) calcium(0) (ISO) carbamazepine (ISO) carbon nanotube (ISO) CGP 52608 (ISO) chromium(6+) (ISO) chrysene (ISO) cisplatin (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) Cuprizon (EXP) cyclosporin A (ISO) deguelin (ISO) diarsenic trioxide (ISO) diazinon (ISO) Dibutyl phosphate (ISO) diuron (ISO) dorsomorphin (ISO) epoxiconazole (ISO) ethanol (ISO) fenpyroximate (ISO) fenthion (ISO) folic acid (ISO) formaldehyde (ISO) fulvestrant (ISO) glyoxylic acid (EXP) lead(0) (EXP) losartan (EXP) mercury dibromide (ISO) metformin (ISO) methamphetamine (ISO) methapyrilene (ISO) methidathion (ISO) methoxychlor (EXP) methyl methanesulfonate (ISO) methylphenidate (EXP) mono(2-ethylhexyl) phthalate (ISO) N-hexadecanoylsphingosine (ISO) nitrates (ISO) Nor-9-carboxy-delta9-THC (ISO) ozone (ISO) panobinostat (ISO) paracetamol (EXP,ISO) pentanal (ISO) perfluorooctane-1-sulfonic acid (ISO) phenethyl caffeate (ISO) phenylephrine (ISO) phenylmercury acetate (ISO) picoxystrobin (ISO) potassium chromate (ISO) propiconazole (EXP) quercetin (ISO) rac-lactic acid (ISO) resveratrol (ISO) rimonabant (ISO) rotenone (ISO) SB 431542 (ISO) sodium arsenite (ISO) sodium dichromate (EXP,ISO) sodium fluoride (ISO) succimer (ISO) tamibarotene (ISO) tauroursodeoxycholic acid (ISO) tebufenpyrad (ISO) thapsigargin (ISO) thifluzamide (ISO) thioacetamide (EXP) torcetrapib (ISO) trichostatin A (ISO) triclosan (ISO) triphenyl phosphate (ISO) trovafloxacin (ISO) tungsten (ISO) valproic acid (EXP,ISO) vancomycin (ISO) vorinostat (ISO) xestospongin C (ISO)
Molecular Function
ATP binding (IEA) calcium channel activity (IEA) calcium ion binding (IBA,IDA) inositol 1,4,5 trisphosphate binding (IBA,IDA,IEA) inositol 1,4,5-trisphosphate-gated calcium channel activity (IBA,IDA,IEA,IMP,ISO) intracellularly gated calcium channel activity (ISO) metal ion binding (IEA) monoatomic ion channel activity (IEA) nucleotide binding (IEA) phosphatidylinositol binding (IBA,ISO) protein binding (IPI,ISO) scaffold protein binding (ISO) transmembrane transporter binding (ISO)
1.
Ca2+-calmodulin inhibits Ca2+ release mediated by type-1, -2 and -3 inositol trisphosphate receptors.
Adkins CE, etal., Biochem J. 2000 Jan 15;345 Pt 2(Pt 2):357-63.
2.
Nuclear inositol 1,4,5-trisphosphate receptors regulate local Ca2+ transients and modulate cAMP response element binding protein phosphorylation.
Cardenas C, etal., J Cell Sci. 2005 Jul 15;118(Pt 14):3131-40.
3.
Mutual antagonism between IP(3)RII and miRNA-133a regulates calcium signals and cardiac hypertrophy.
Drawnel FM, etal., J Cell Biol. 2012 Nov 26;199(5):783-98. doi: 10.1083/jcb.201111095. Epub 2012 Nov 19.
4.
Organelles containing inositol trisphosphate receptor type 2 in adrenal medullary cells.
Endo Y, etal., J Physiol Sci. 2006 Dec;56(6):415-23. Epub 2006 Nov 3.
5.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
6.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
7.
Regulation of Ca(2+) signaling in rat bile duct epithelia by inositol 1,4,5-trisphosphate receptor isoforms.
Hirata K, etal., Hepatology 2002 Aug;36(2):284-96.
8.
Hypoxia modulates gene expression of IP3 receptors in rodent cerebellum.
Jurkovicova D, etal., Pflugers Arch. 2007 Jun;454(3):415-25. Epub 2007 Feb 7.
9.
Expression profiles of three isoforms of inositol 1,4,5-trisphosphate receptor in brown adipose tissue of the rat.
Kajimoto K, etal., Biochem Pharmacol 2003 Mar 15;65(6):995-8.
10.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
11.
Characterization of inositol 1,4,5-trisphosphate receptor isoform mRNA expression and regulation in rat pancreatic islets, RINm5F cells and betaHC9 cells.
Lee B, etal., J Mol Endocrinol 1998 Aug;21(1):31-9.
12.
Immobilization stress elevates IP(3) receptor mRNA in adult rat hearts in a glucocorticoid-dependent manner.
Lencesova L, etal., FEBS Lett 2002 Nov 20;531(3):432-6.
13.
Modulation of inositol 1,4,5-trisphosphate receptor type 2 channel activity by Ca2+/calmodulin-dependent protein kinase II (CaMKII)-mediated phosphorylation.
Maxwell JT, etal., J Biol Chem. 2012 Nov 16;287(47):39419-28. doi: 10.1074/jbc.M112.374058. Epub 2012 Sep 26.
14.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
15.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
16.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
17.
Single-channel function of recombinant type 2 inositol 1,4, 5-trisphosphate receptor.
Ramos-Franco J, etal., Biophys J. 2000 Sep;79(3):1388-99.
18.
GOA pipeline
RGD automated data pipeline
19.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
20.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
21.
The Bcl-2 protein family member Bok binds to the coupling domain of inositol 1,4,5-trisphosphate receptors and protects them from proteolytic cleavage.
Schulman JJ, etal., J Biol Chem. 2013 Aug 30;288(35):25340-9. doi: 10.1074/jbc.M113.496570. Epub 2013 Jul 24.
22.
Structure of a novel InsP3 receptor.
Sudhof TC, etal., EMBO J 1991 Nov;10(11):3199-206.
23.
Signaling proteins in the axoglial apparatus of sciatic nerve nodes of Ranvier.
Toews JC, etal., Glia. 2007 Jan 15;55(2):202-13.
24.
Functional characterization of mammalian inositol 1,4,5-trisphosphate receptor isoforms.
Tu H, etal., Biophys J. 2005 Feb;88(2):1046-55. Epub 2004 Nov 8.
25.
ITPR2 as a susceptibility gene in sporadic amyotrophic lateral sclerosis: a genome-wide association study.
van Es MA, etal., Lancet Neurol. 2007 Oct;6(10):869-77.
26.
Regulation of inositol 1,4,5-trisphosphate-induced Ca2+ release by reversible phosphorylation and dephosphorylation.
Vanderheyden V, etal., Biochim Biophys Acta. 2009 Jun;1793(6):959-70. doi: 10.1016/j.bbamcr.2008.12.003. Epub 2008 Dec 16.
27.
Disrupted placental vitamin D metabolism and calcium signaling in gestational diabetes and pre-eclampsia patients.
Varshney S, etal., Endocrine. 2023 Apr;80(1):191-200. doi: 10.1007/s12020-022-03272-9. Epub 2022 Dec 8.
28.
Differential regulation of the InsP₃ receptor type-1 and -2 single channel properties by InsP₃, Ca²⁺ and ATP.
Wagner LE and Yule DI, J Physiol. 2012 Jul 15;590(14):3245-59. doi: 10.1113/jphysiol.2012.228320. Epub 2012 Apr 30.
Itpr2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 180,759,325 - 181,165,361 (-) NCBI GRCr8 mRatBN7.2 4 179,028,594 - 179,434,657 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 179,027,281 - 179,404,164 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 185,313,424 - 185,690,245 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 181,097,944 - 181,474,767 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 179,718,376 - 180,095,194 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 180,423,452 - 180,800,088 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 180,538,389 - 180,722,358 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 244,585,711 - 244,960,429 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 183,677,606 - 184,066,130 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 183,922,730 - 184,311,254 (-) NCBI Celera 4 167,526,971 - 167,901,481 (-) NCBI Celera RH 3.4 Map 4 1070.3 RGD Cytogenetic Map 4 q44 NCBI
ITPR2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 26,335,352 - 26,833,194 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 26,335,352 - 26,833,194 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 26,488,285 - 26,986,127 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 26,379,552 - 26,877,398 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 26,381,611 - 26,877,398 NCBI Celera 12 31,634,797 - 32,132,275 (-) NCBI Celera Cytogenetic Map 12 p11.23 NCBI HuRef 12 26,258,420 - 26,756,231 (-) NCBI HuRef CHM1_1 12 26,453,424 - 26,951,168 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 26,207,897 - 26,705,197 (-) NCBI T2T-CHM13v2.0
Itpr2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 146,009,797 - 146,403,757 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 146,009,797 - 146,403,721 (-) Ensembl GRCm39 Ensembl GRCm38 6 146,108,299 - 146,502,258 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 146,108,299 - 146,502,223 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 146,060,002 - 146,450,434 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 146,068,650 - 146,459,082 (-) NCBI MGSCv36 mm8 Celera 6 149,142,524 - 149,540,657 (-) NCBI Celera Cytogenetic Map 6 G3 NCBI cM Map 6 77.7 NCBI
Itpr2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 21,291,110 - 21,719,303 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 21,289,673 - 21,719,610 (-) NCBI ChiLan1.0 ChiLan1.0
ITPR2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 69,981,191 - 70,487,626 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 69,978,015 - 70,484,024 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 59,478,206 - 59,984,572 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 62,093,208 - 62,596,018 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 62,092,241 - 62,596,018 (+) Ensembl panpan1.1 panPan2
ITPR2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 20,806,670 - 21,278,638 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 20,805,842 - 21,350,083 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 25,103,914 - 25,581,983 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 21,001,355 - 21,474,042 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 21,001,392 - 21,471,311 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 20,812,377 - 21,283,928 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 20,834,447 - 21,306,590 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 25,271,849 - 25,744,599 (-) NCBI UU_Cfam_GSD_1.0
Itpr2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 82,723,135 - 83,198,963 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936548 645,925 - 1,121,888 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936548 646,019 - 1,120,426 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ITPR2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 46,935,932 - 47,464,125 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 46,935,923 - 47,465,681 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 50,482,341 - 50,738,864 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ITPR2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 26,089,480 - 26,574,621 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 26,089,484 - 26,574,950 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666069 8,498,077 - 8,981,050 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Itpr2
.
Predicted Target Of
Count of predictions: 536 Count of miRNA genes: 260 Interacting mature miRNAs: 356 Transcripts: ENSRNOT00000040645 Prediction methods: Miranda, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1300109 Rf13 Renal function QTL 13 3.91 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 4 157710145 182687754 Rat
D4Mgh12
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 181,024,547 - 181,024,663 (+) Marker Load Pipeline mRatBN7.2 4 179,293,830 - 179,293,946 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,689,009 - 180,689,124 NCBI Rnor6.0 Rnor_5.0 4 244,849,397 - 244,849,512 UniSTS Rnor5.0 RGSC_v3.4 4 183,954,704 - 183,954,820 RGD RGSC3.4 RGSC_v3.4 4 183,954,705 - 183,954,820 UniSTS RGSC3.4 RGSC_v3.1 4 184,199,829 - 184,199,944 RGD Celera 4 167,791,605 - 167,791,720 UniSTS RH 3.4 Map 4 1076.3 RGD RH 3.4 Map 4 1076.3 UniSTS Cytogenetic Map 4 q44 UniSTS
D4Got297
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 179,306,094 - 179,306,252 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,701,272 - 180,701,429 NCBI Rnor6.0 Rnor_5.0 4 244,861,660 - 244,861,817 UniSTS Rnor5.0 RGSC_v3.4 4 183,966,968 - 183,967,125 UniSTS RGSC3.4 Celera 4 167,803,868 - 167,804,024 UniSTS Cytogenetic Map 4 q44 UniSTS
RH133051
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 179,193,874 - 179,194,068 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,588,969 - 180,589,162 NCBI Rnor6.0 Rnor_5.0 4 244,750,238 - 244,750,431 UniSTS Rnor5.0 RGSC_v3.4 4 183,851,398 - 183,851,591 UniSTS RGSC3.4 Celera 4 167,693,028 - 167,693,221 UniSTS RH 3.4 Map 4 1070.3 UniSTS Cytogenetic Map 4 q44 UniSTS
BE110085
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 179,031,636 - 179,031,796 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,425,378 - 180,425,537 NCBI Rnor6.0 Rnor_5.0 4 244,587,637 - 244,587,796 UniSTS Rnor5.0 RGSC_v3.4 4 183,679,532 - 183,679,691 UniSTS RGSC3.4 Celera 4 167,528,897 - 167,529,056 UniSTS RH 3.4 Map 4 1070.3 UniSTS Cytogenetic Map 4 q44 UniSTS
AU046614
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 179,122,021 - 179,122,202 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,517,272 - 180,517,452 NCBI Rnor6.0 Rnor_5.0 4 244,678,915 - 244,679,095 UniSTS Rnor5.0 RGSC_v3.4 4 183,775,106 - 183,775,286 UniSTS RGSC3.4 Celera 4 167,621,203 - 167,621,379 UniSTS Cytogenetic Map 4 q44 UniSTS
BE100309
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 179,278,276 - 179,278,427 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,673,476 - 180,673,626 NCBI Rnor6.0 Rnor_5.0 4 244,833,770 - 244,833,920 UniSTS Rnor5.0 RGSC_v3.4 4 183,938,620 - 183,938,770 UniSTS RGSC3.4 Celera 4 167,776,080 - 167,776,230 UniSTS RH 3.4 Map 4 1070.3 UniSTS Cytogenetic Map 4 q44 UniSTS
Itpr2
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 180,966,025 - 180,966,817 (+) Marker Load Pipeline mRatBN7.2 4 179,235,304 - 179,236,096 (+) MAPPER mRatBN7.2 Rnor_6.0 4 180,630,279 - 180,631,070 NCBI Rnor6.0 Rnor_5.0 4 244,791,039 - 244,791,830 UniSTS Rnor5.0 RGSC_v3.4 4 183,893,167 - 183,893,958 UniSTS RGSC3.4 Celera 4 167,734,499 - 167,735,290 UniSTS RH 3.4 Map 4 1070.3 UniSTS Cytogenetic Map 4 q44 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000040255 ⟹ ENSRNOP00000043615
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,029,714 - 179,404,164 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000040645 ⟹ ENSRNOP00000047905
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,082,013 - 179,404,164 (-) Ensembl Rnor_6.0 Ensembl 4 180,538,389 - 180,722,358 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000086465 ⟹ ENSRNOP00000072117
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,029,714 - 179,108,199 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000103103 ⟹ ENSRNOP00000077641
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,029,714 - 179,404,164 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000109175 ⟹ ENSRNOP00000096862
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,027,281 - 179,404,164 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000118898 ⟹ ENSRNOP00000077632
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 179,086,247 - 179,404,164 (-) Ensembl
RefSeq Acc Id:
NM_031046 ⟹ NP_112308
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,760,442 - 181,134,867 (-) NCBI mRatBN7.2 4 179,029,711 - 179,404,164 (-) NCBI Rnor_6.0 4 180,423,452 - 180,800,088 (-) NCBI Rnor_5.0 4 244,585,711 - 244,960,429 (-) NCBI RGSC_v3.4 4 183,677,606 - 184,066,130 (-) RGD Celera 4 167,526,971 - 167,901,481 (-) RGD
Sequence:
GGGACGCAGAGGGAGCGCGGGCCAGGGAGGAGGAGCGAAGGTGTAGGACAGAACTTCGCCAGGAACAGGAAACCCACGGCCGGGCAGGGGCGGCGACGGCGGCGCGGGGCCATCGCAGTGTCCCCAGC
hide sequence
RefSeq Acc Id:
XM_039108425 ⟹ XP_038964353
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,165,361 (-) NCBI mRatBN7.2 4 179,028,594 - 179,434,657 (-) NCBI
RefSeq Acc Id:
XM_039108427 ⟹ XP_038964355
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,165,315 (-) NCBI mRatBN7.2 4 179,028,594 - 179,434,606 (-) NCBI
RefSeq Acc Id:
XM_039108428 ⟹ XP_038964356
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,134,987 (-) NCBI mRatBN7.2 4 179,028,594 - 179,404,267 (-) NCBI
RefSeq Acc Id:
XM_039108429 ⟹ XP_038964357
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,165,315 (-) NCBI mRatBN7.2 4 179,028,594 - 179,434,606 (-) NCBI
RefSeq Acc Id:
XM_039108430 ⟹ XP_038964358
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,165,315 (-) NCBI mRatBN7.2 4 179,028,594 - 179,434,606 (-) NCBI
RefSeq Acc Id:
XM_063286748 ⟹ XP_063142818
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 180,759,325 - 181,165,338 (-) NCBI
RefSeq Acc Id:
NP_112308 ⟸ NM_031046
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
- Sequence:
MSDKMSSFLYIGDIVSLYAEGSVNGFISTLGLVDDRCVVHPEAGDLTNPPKKFRDCLFKVCPMNRYSAQKQYWKAKQAKQGNHTEAALLKKLQHAAELEQKQNESENRKLLGEIVKYSKVIQLLHIKS
hide sequence
Ensembl Acc Id:
ENSRNOP00000047905 ⟸ ENSRNOT00000040645
RefSeq Acc Id:
XP_038964353 ⟸ XM_039108425
- Peptide Label:
isoform X1
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038964355 ⟸ XM_039108427
- Peptide Label:
isoform X2
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038964357 ⟸ XM_039108429
- Peptide Label:
isoform X4
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038964358 ⟸ XM_039108430
- Peptide Label:
isoform X4
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038964356 ⟸ XM_039108428
- Peptide Label:
isoform X3
- UniProtKB:
F1LNT1 (UniProtKB/TrEMBL), Q6W3E4 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000043615 ⟸ ENSRNOT00000040255
Ensembl Acc Id:
ENSRNOP00000096862 ⟸ ENSRNOT00000109175
Ensembl Acc Id:
ENSRNOP00000077641 ⟸ ENSRNOT00000103103
Ensembl Acc Id:
ENSRNOP00000077632 ⟸ ENSRNOT00000118898
Ensembl Acc Id:
ENSRNOP00000072117 ⟸ ENSRNOT00000086465
RefSeq Acc Id:
XP_063142818 ⟸ XM_063286748
- Peptide Label:
isoform X1
- UniProtKB:
Q6W3E4 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Itpr2
inositol 1,4,5-trisphosphate receptor, type 2
LOC102553163
uncharacterized LOC102553163
Data merged from RGD:7717500
737654 PROVISIONAL
2013-12-18
LOC102553163
uncharacterized LOC102553163
Symbol and Name status set to provisional
70820 PROVISIONAL
2011-08-02
Itpr2
inositol 1,4,5-trisphosphate receptor, type 2
Itpr2
inositol 1,4,5-triphosphate receptor, type 2
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-11-17
Itpr2
inositol 1,4,5-triphosphate receptor, type 2
Itpr2
inositol 1,4,5-triphosphate receptor 2
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2003-04-09
Itpr2
inositol 1,4,5-triphosphate receptor 2
inositol 1,4,5-triphosphate receptor type 2
Symbol and Name status set to approved
629479 APPROVED
2002-06-10
Itpr2
inositol 1,4,5-triphosphate receptor type 2
Name updated
70585 PROVISIONAL
2002-02-26
Itpr2
inositol 1,4,5-triphosphate receptor 2
Name updated
70292 APPROVED
Note Type
Note
Reference
gene_expression
predominantly expressed in brown adipose tissue
727515
gene_function
intracellular Ca2+ channel, receptor for Insp3 (inositol 1,4,5-triphosphate) that causes the release of Ca ++ from intracellular stores
68894
gene_function
intracellular Ca2+ channel, receptor for Insp3 (inositol 1,4,5-triphosphate) that causes the release of Ca ++ from intracellular stores
69501
gene_process
plays a role in the regulation of insulin secretion
68894
gene_process
plays a role in the regulation of insulin secretion
69501
gene_regulation
mRNA expression elevated in cardiac atria and ventricles by stress
729245
