Symbol:
Pgk1
Name:
phosphoglycerate kinase 1
RGD ID:
619878
Description:
Enables ADP binding activity; ATP binding activity; and phosphoglycerate kinase activity. Involved in gluconeogenesis and glycolytic process. Predicted to be located in extracellular space; membrane raft; and mitochondrial matrix. Predicted to be active in cytosol. Human ortholog(s) of this gene implicated in hemolytic anemia and phosphoglycerate kinase 1 deficiency. Orthologous to human PGK1 (phosphoglycerate kinase 1); PARTICIPATES IN gluconeogenesis pathway; glycolysis pathway; hypoxia inducible factor pathway; INTERACTS WITH 1,2,4-trimethylbenzene; 17alpha-ethynylestradiol; 17beta-estradiol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
MGC105265; Pgk
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PGK1 (phosphoglycerate kinase 1) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, Panther, PhylomeDB
Mus musculus (house mouse):
Pgk1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pgk1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PGK1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PGK1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pgk1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PGK1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PGK1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pgk1 (phosphoglycerate kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
PGK2 (phosphoglycerate kinase 2) HGNC
OrthoDB
Homo sapiens (human):
CLIC1 (chloride intracellular channel 1) HGNC
OMA
Alliance orthologs 3
Mus musculus (house mouse):
Pgk1 (phosphoglycerate kinase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
PGK1 (phosphoglycerate kinase 1)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pgk1 (phosphoglycerate kinase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
PGK1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Pgk
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
pgk-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
pgk1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 X 75,336,988 - 75,352,962 (+) NCBI GRCr8 mRatBN7.2 X 71,271,454 - 71,287,429 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl X 71,271,440 - 71,287,418 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx X 72,780,371 - 72,796,345 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 X 76,280,383 - 76,296,357 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 X 73,843,195 - 73,859,169 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 X 77,263,399 - 77,279,373 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl X 77,263,359 - 77,279,367 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 X 56,383,459 - 56,399,433 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 X 94,324,219 - 94,340,193 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 X 94,397,574 - 94,413,625 (+) NCBI Celera X 72,583,654 - 72,599,628 (+) NCBI Celera Cytogenetic Map X q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pgk1 Rat (-)-epigallocatechin 3-gallate increases expression ISO PGK1 (Homo sapiens) 6480464 epigallocatechin gallate results in increased expression of PGK1 protein CTD PMID:31195006 Pgk1 Rat (R,R,R)-alpha-tocopherol multiple interactions ISO PGK1 (Homo sapiens) 6480464 alpha-Tocopherol inhibits the reaction [Hydrogen Peroxide results in increased expression of PGK1 protein] CTD PMID:18603805 Pgk1 Rat (Z)-3-butylidenephthalide decreases expression ISO PGK1 (Homo sapiens) 6480464 butylidenephthalide results in decreased expression of PGK1 protein CTD PMID:23770345 Pgk1 Rat 1,10-phenanthroline increases expression ISO PGK1 (Homo sapiens) 6480464 1 and 10-phenanthroline results in increased expression of PGK1 mRNA CTD PMID:19502547 Pgk1 Rat 1,2,4-trimethylbenzene decreases expression EXP 6480464 pseudocumene results in decreased expression of PGK1 protein CTD PMID:17337753 Pgk1 Rat 1,2-dimethylhydrazine decreases expression ISO Pgk1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of PGK1 mRNA CTD PMID:22206623 Pgk1 Rat 1,2-dimethylhydrazine multiple interactions ISO Pgk1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of PGK1 mRNA CTD PMID:22206623 Pgk1 Rat 1,4-benzoquinone increases expression ISO PGK1 (Homo sapiens) 6480464 quinone results in increased expression of PGK1 protein CTD PMID:30448556 Pgk1 Rat 1,4-benzoquinone multiple interactions ISO PGK1 (Homo sapiens) 6480464 [HIF1A protein co-treated with quinone] results in increased expression of PGK1 protein CTD PMID:30448556 Pgk1 Rat 17alpha-ethynylestradiol increases expression ISO Pgk1 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PGK1 mRNA CTD PMID:16174780 and PMID:19400957 Pgk1 Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of PGK1 mRNA CTD PMID:12075121 more ... Pgk1 Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of PGK1 mRNA CTD PMID:32145629 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Pgk1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA CTD PMID:15667827 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of PGK1 mRNA CTD PMID:34747641 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO PGK1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA CTD PMID:23152189 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO PGK1 (Homo sapiens) 6480464 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA] and alpha-naphthoflavone inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA] CTD PMID:23152189 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Pgk1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of PGK1 mRNA CTD PMID:21570461 Pgk1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA CTD PMID:16466705 and PMID:21215274 Pgk1 Rat 2,6-di-tert-butyl-4-methylphenol multiple interactions ISO PGK1 (Homo sapiens) 6480464 Butylated Hydroxytoluene inhibits the reaction [Hydrogen Peroxide results in increased expression of PGK1 protein] CTD PMID:18603805 Pgk1 Rat 2,6-dimethoxyphenol multiple interactions ISO PGK1 (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Pgk1 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression EXP 6480464 3 more ... CTD PMID:23196670 Pgk1 Rat 3,3',4,4',5-pentachlorobiphenyl affects expression ISO Pgk1 (Mus musculus) 6480464 3 more ... CTD PMID:37080397 Pgk1 Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO PGK1 (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of PGK1 protein CTD PMID:30098271 Pgk1 Rat 4,4'-diaminodiphenylmethane increases expression ISO Pgk1 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in increased expression of PGK1 mRNA CTD PMID:18648102 Pgk1 Rat 4,4'-sulfonyldiphenol increases expression ISO Pgk1 (Mus musculus) 6480464 bisphenol S results in increased expression of PGK1 mRNA CTD PMID:39298647 Pgk1 Rat 4,4'-sulfonyldiphenol increases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol S results in increased expression of PGK1 protein CTD PMID:34186270 Pgk1 Rat 5-chloro-7-iodoquinolin-8-ol increases expression ISO PGK1 (Homo sapiens) 6480464 Clioquinol results in increased expression of PGK1 mRNA CTD PMID:19502547 Pgk1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of PGK1 mRNA CTD PMID:30047161 Pgk1 Rat actinomycin D multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of PGK1 protein CTD PMID:38460933 Pgk1 Rat aflatoxin B1 decreases methylation ISO PGK1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of PGK1 gene CTD PMID:27153756 Pgk1 Rat all-trans-retinoic acid decreases expression ISO PGK1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of PGK1 protein CTD PMID:17051635 Pgk1 Rat all-trans-retinoic acid increases expression ISO PGK1 (Homo sapiens) 6480464 Tretinoin results in increased expression of PGK1 mRNA CTD PMID:33167477 Pgk1 Rat alpha-naphthoflavone multiple interactions ISO PGK1 (Homo sapiens) 6480464 alpha-naphthoflavone inhibits the reaction [Tetrachlorodibenzodioxin results in decreased expression of PGK1 mRNA] CTD PMID:23152189 Pgk1 Rat alpha-naphthoflavone increases expression ISO PGK1 (Homo sapiens) 6480464 alpha-naphthoflavone results in increased expression of PGK1 mRNA CTD PMID:23152189 Pgk1 Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of PGK1 mRNA CTD PMID:35163327 Pgk1 Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of PGK1 mRNA CTD PMID:30047161 Pgk1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PGK1 mRNA CTD PMID:16483693 Pgk1 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of PGK1 mRNA CTD PMID:30779732 Pgk1 Rat amphotericin B multiple interactions ISO PGK1 (Homo sapiens) 6480464 Amphotericin B inhibits the reaction [Oxygen deficiency results in increased expression of PGK1 mRNA] CTD PMID:16189267 Pgk1 Rat antimycin A decreases expression ISO PGK1 (Homo sapiens) 6480464 Antimycin A results in decreased expression of PGK1 mRNA CTD PMID:33512557 Pgk1 Rat antirheumatic drug decreases expression ISO PGK1 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of PGK1 mRNA CTD PMID:24449571 Pgk1 Rat aristolochic acid A decreases expression ISO PGK1 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of PGK1 mRNA CTD PMID:33212167 Pgk1 Rat Aroclor 1254 decreases expression ISO Pgk1 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of PGK1 mRNA CTD PMID:23650126 Pgk1 Rat arsane decreases expression EXP 6480464 Arsenic results in decreased expression of PGK1 mRNA CTD PMID:18315880 Pgk1 Rat arsane multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat arsane affects methylation ISO PGK1 (Homo sapiens) 6480464 Arsenic affects the methylation of PGK1 gene CTD PMID:25304211 Pgk1 Rat arsane affects expression EXP 6480464 Arsenic affects the expression of PGK1 mRNA CTD PMID:18315880 Pgk1 Rat arsenic atom affects expression EXP 6480464 Arsenic affects the expression of PGK1 mRNA CTD PMID:18315880 Pgk1 Rat arsenic atom multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat arsenic atom affects methylation ISO PGK1 (Homo sapiens) 6480464 Arsenic affects the methylation of PGK1 gene CTD PMID:25304211 Pgk1 Rat arsenic atom decreases expression EXP 6480464 Arsenic results in decreased expression of PGK1 mRNA CTD PMID:18315880 Pgk1 Rat arsenite(3-) multiple interactions ISO PGK1 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to PGK1 protein] CTD PMID:32406909 Pgk1 Rat arsenous acid increases expression ISO PGK1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of PGK1 mRNA CTD PMID:22521957 Pgk1 Rat arsenous acid decreases expression ISO PGK1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of PGK1 mRNA and Arsenic Trioxide results in decreased expression of PGK1 protein CTD PMID:38160894 Pgk1 Rat arsenous acid multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of PGK1 protein more ... CTD PMID:26598702 and PMID:38160894 Pgk1 Rat Azaspiracid increases expression ISO PGK1 (Homo sapiens) 6480464 azaspiracid results in increased expression of PGK1 mRNA CTD PMID:28939011 Pgk1 Rat azoxystrobin multiple interactions EXP 6480464 [azoxystrobin co-treated with 2-chloro-N-(4-chlorobiphenyl-2-yl)nicotinamide co-treated with Chlorpyrifos co-treated with Glyphosate co-treated with imidacloprid co-treated with Thiabendazole] results in decreased expression of PGK1 mRNA CTD PMID:33854195 Pgk1 Rat beauvericin multiple interactions ISO PGK1 (Homo sapiens) 6480464 [beauvericin co-treated with enniatins] results in increased expression of PGK1 protein CTD PMID:32407736 Pgk1 Rat benzatropine decreases expression ISO PGK1 (Homo sapiens) 6480464 Benztropine results in decreased expression of PGK1 protein CTD PMID:34122009 Pgk1 Rat benzene increases expression ISO PGK1 (Homo sapiens) 6480464 Benzene results in increased expression of PGK1 mRNA CTD PMID:19162166 Pgk1 Rat benzo[a]pyrene increases mutagenesis ISO PGK1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased mutagenesis of PGK1 gene CTD PMID:25435355 Pgk1 Rat benzo[a]pyrene affects methylation ISO PGK1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PGK1 exon and Benzo(a)pyrene affects the methylation of PGK1 promoter CTD PMID:27901495 Pgk1 Rat benzo[a]pyrene decreases methylation ISO PGK1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of PGK1 3' UTR CTD PMID:27901495 Pgk1 Rat benzo[a]pyrene decreases expression ISO PGK1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of PGK1 mRNA CTD PMID:21632981 Pgk1 Rat benzo[a]pyrene diol epoxide I increases expression ISO PGK1 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Pgk1 Rat bis(2-ethylhexyl) phthalate increases expression ISO PGK1 (Homo sapiens) 6480464 Diethylhexyl Phthalate results in increased expression of PGK1 mRNA CTD PMID:31163220 Pgk1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Pgk1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of PGK1 mRNA CTD PMID:33754040 Pgk1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PGK1 mRNA and bisphenol A results in increased expression of PGK1 protein CTD PMID:12075121 more ... Pgk1 Rat bisphenol A increases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol A results in increased expression of PGK1 protein CTD PMID:37567409 Pgk1 Rat bisphenol A decreases expression ISO Pgk1 (Mus musculus) 6480464 bisphenol A results in decreased expression of PGK1 protein CTD PMID:35999755 Pgk1 Rat bisphenol A decreases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of PGK1 protein CTD PMID:34186270 Pgk1 Rat bisphenol A affects expression ISO PGK1 (Homo sapiens) 6480464 bisphenol A affects the expression of PGK1 mRNA CTD PMID:30903817 Pgk1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PGK1 mRNA CTD PMID:30816183 and PMID:32528016 Pgk1 Rat bisphenol AF increases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol AF results in increased expression of PGK1 protein CTD PMID:34186270 Pgk1 Rat Bisphenol B increases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol B results in increased expression of PGK1 protein CTD PMID:34186270 Pgk1 Rat bisphenol F increases expression ISO PGK1 (Homo sapiens) 6480464 bisphenol F results in increased expression of PGK1 protein CTD PMID:34186270 Pgk1 Rat bisphenol F increases expression ISO Pgk1 (Mus musculus) 6480464 bisphenol F results in increased expression of PGK1 mRNA CTD PMID:38685157 Pgk1 Rat bromobenzene affects binding EXP 6480464 bromobenzene metabolite binds to PGK1 protein CTD PMID:17305373 Pgk1 Rat buspirone decreases expression EXP 6480464 Buspirone results in decreased expression of PGK1 mRNA CTD PMID:24136188 Pgk1 Rat cadmium atom decreases expression ISO PGK1 (Homo sapiens) 6480464 Cadmium results in decreased expression of PGK1 mRNA CTD PMID:24376830 Pgk1 Rat cadmium atom multiple interactions ISO PGK1 (Homo sapiens) 6480464 Cadmium inhibits the reaction [Oxygen deficiency results in increased expression of PGK1 mRNA] CTD PMID:10866824 Pgk1 Rat cadmium dichloride affects expression ISO PGK1 (Homo sapiens) 6480464 Cadmium Chloride affects the expression of PGK1 mRNA CTD PMID:23828170 Pgk1 Rat cadmium dichloride increases expression ISO PGK1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of PGK1 protein CTD PMID:24527689 Pgk1 Rat caffeine decreases phosphorylation ISO PGK1 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of PGK1 protein CTD PMID:35688186 Pgk1 Rat cannabidiol increases expression ISO Pgk1 (Mus musculus) 6480464 Cannabidiol results in increased expression of PGK1 mRNA CTD PMID:31052254 Pgk1 Rat carbamazepine affects expression ISO PGK1 (Homo sapiens) 6480464 Carbamazepine affects the expression of PGK1 mRNA CTD PMID:25979313 Pgk1 Rat carbon nanotube decreases expression ISO PGK1 (Homo sapiens) 6480464 Nanotubes and Carbon results in decreased expression of PGK1 protein CTD PMID:22157353 Pgk1 Rat carbon nanotube increases expression ISO Pgk1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Pgk1 Rat celastrol multiple interactions ISO Pgk1 (Mus musculus) 6480464 celastrol inhibits the reaction [Dietary Fats results in decreased expression of PGK1 mRNA] CTD PMID:35679966 Pgk1 Rat chlorohydrocarbon increases expression EXP 6480464 Hydrocarbons and Chlorinated results in increased expression of PGK1 mRNA CTD PMID:18077114 Pgk1 Rat chloropicrin affects expression ISO PGK1 (Homo sapiens) 6480464 chloropicrin affects the expression of PGK1 mRNA CTD PMID:26352163 Pgk1 Rat chloropicrin decreases expression ISO PGK1 (Homo sapiens) 6480464 chloropicrin results in decreased expression of PGK1 mRNA CTD PMID:28476498 Pgk1 Rat chlorpyrifos multiple interactions EXP 6480464 [azoxystrobin co-treated with 2-chloro-N-(4-chlorobiphenyl-2-yl)nicotinamide co-treated with Chlorpyrifos co-treated with Glyphosate co-treated with imidacloprid co-treated with Thiabendazole] results in decreased expression of PGK1 mRNA CTD PMID:33854195 Pgk1 Rat cisplatin affects response to substance ISO PGK1 (Homo sapiens) 6480464 PGK1 affects the susceptibility to Cisplatin CTD PMID:15756446 Pgk1 Rat cisplatin decreases expression ISO PGK1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of PGK1 mRNA CTD PMID:27594783 Pgk1 Rat clobetasol increases expression ISO Pgk1 (Mus musculus) 6480464 Clobetasol results in increased expression of PGK1 mRNA CTD PMID:27462272 Pgk1 Rat clozapine increases expression EXP 6480464 Clozapine results in increased expression of PGK1 mRNA CTD PMID:15860345 Pgk1 Rat cobalt dichloride multiple interactions ISO PGK1 (Homo sapiens) 6480464 cobaltous chloride promotes the reaction [Oxygen deficiency results in increased expression of PGK1 mRNA] more ... CTD PMID:22202117 more ... Pgk1 Rat cobalt dichloride increases expression ISO PGK1 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of PGK1 mRNA CTD PMID:17553155 more ... Pgk1 Rat cobalt dichloride increases expression EXP 6480464 cobaltous chloride results in increased expression of PGK1 mRNA and cobaltous chloride results in increased expression of PGK1 protein CTD PMID:24386269 Pgk1 Rat cobalt(2+) sulfate increases expression ISO PGK1 (Homo sapiens) 6480464 cobalt sulfate results in increased expression of PGK1 mRNA CTD PMID:19502547 Pgk1 Rat copper atom affects binding ISO PGK1 (Homo sapiens) 6480464 PGK1 protein binds to Copper CTD PMID:15359738 Pgk1 Rat copper(0) affects binding ISO PGK1 (Homo sapiens) 6480464 PGK1 protein binds to Copper CTD PMID:15359738 Pgk1 Rat coumarin increases phosphorylation ISO PGK1 (Homo sapiens) 6480464 coumarin results in increased phosphorylation of PGK1 protein CTD PMID:35688186 Pgk1 Rat coumestrol increases expression ISO PGK1 (Homo sapiens) 6480464 Coumestrol results in increased expression of PGK1 mRNA CTD PMID:19167446 Pgk1 Rat cyclosporin A decreases expression ISO PGK1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of PGK1 mRNA CTD PMID:21163907 and PMID:25562108 Pgk1 Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of PGK1 mRNA CTD PMID:23914054 Pgk1 Rat deguelin decreases expression ISO PGK1 (Homo sapiens) 6480464 deguelin results in decreased expression of PGK1 mRNA CTD PMID:33512557 Pgk1 Rat delphinidin multiple interactions ISO PGK1 (Homo sapiens) 6480464 delphinidin inhibits the reaction [Hydrogen Peroxide results in increased expression of PGK1 protein] CTD PMID:18603805 Pgk1 Rat desferrioxamine B multiple interactions ISO PGK1 (Homo sapiens) 6480464 ferric ammonium citrate inhibits the reaction [Deferoxamine results in increased expression of PGK1 protein] CTD PMID:19515424 Pgk1 Rat desferrioxamine B increases expression ISO PGK1 (Homo sapiens) 6480464 Deferoxamine results in increased expression of PGK1 mRNA CTD PMID:22447124 and PMID:34998824 Pgk1 Rat desferrioxamine B decreases expression ISO PGK1 (Homo sapiens) 6480464 Deferoxamine results in decreased expression of PGK1 protein CTD PMID:19515424 Pgk1 Rat dexamethasone decreases expression ISO Pgk1 (Mus musculus) 6480464 Dexamethasone results in decreased expression of PGK1 protein CTD PMID:33567340 Pgk1 Rat dextran sulfate decreases expression ISO Pgk1 (Mus musculus) 6480464 Dextran Sulfate results in decreased expression of PGK1 protein CTD PMID:35999755 Pgk1 Rat diallyl trisulfide increases expression ISO PGK1 (Homo sapiens) 6480464 diallyl trisulfide results in increased expression of PGK1 protein CTD PMID:16344271 Pgk1 Rat diarsenic trioxide multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of PGK1 protein more ... CTD PMID:26598702 and PMID:38160894 Pgk1 Rat diarsenic trioxide decreases expression ISO PGK1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of PGK1 mRNA and Arsenic Trioxide results in decreased expression of PGK1 protein CTD PMID:38160894 Pgk1 Rat diarsenic trioxide increases expression ISO PGK1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of PGK1 mRNA CTD PMID:22521957 Pgk1 Rat Dibutyl phosphate affects expression ISO PGK1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of PGK1 mRNA CTD PMID:37042841 Pgk1 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of PGK mRNA and Dibutyl Phthalate results in decreased expression of PGK1 mRNA CTD PMID:17379624 and PMID:21266533 Pgk1 Rat dihydroartemisinin affects binding ISO PGK1 (Homo sapiens) 6480464 artenimol analog binds to PGK1 protein CTD PMID:26340163 Pgk1 Rat dimercaprol multiple interactions ISO PGK1 (Homo sapiens) 6480464 Dimercaprol inhibits the reaction [4-aminophenylarsenoxide binds to PGK1 protein] CTD PMID:26598702 Pgk1 Rat dioxygen multiple interactions ISO PGK1 (Homo sapiens) 6480464 [IL15 protein co-treated with Oxygen deficiency] results in increased expression of PGK1 mRNA more ... CTD PMID:10866824 more ... Pgk1 Rat dioxygen increases expression ISO PGK1 (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of PGK1 mRNA CTD PMID:10866824 more ... Pgk1 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with AQP3 protein] results in increased expression of PGK1 mRNA CTD PMID:23545307 Pgk1 Rat dioxygen increases expression EXP 6480464 Oxygen deficiency results in increased expression of PGK1 mRNA and Oxygen results in increased expression of PGK1 mRNA CTD PMID:15225644 more ... Pgk1 Rat dioxygen increases expression ISO Pgk1 (Mus musculus) 6480464 Oxygen deficiency results in increased expression of PGK1 mRNA CTD PMID:20880076 Pgk1 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of PGK1 mRNA CTD PMID:21551480 Pgk1 Rat diuron decreases expression ISO PGK1 (Homo sapiens) 6480464 Diuron results in decreased expression of PGK1 mRNA CTD PMID:35967413 Pgk1 Rat dopamine decreases expression EXP 6480464 Dopamine results in decreased expression of PGK1 mRNA CTD PMID:21983523 Pgk1 Rat doxorubicin increases expression ISO PGK1 (Homo sapiens) 6480464 Doxorubicin results in increased expression of PGK1 mRNA CTD PMID:29803840 Pgk1 Rat enniatin multiple interactions ISO PGK1 (Homo sapiens) 6480464 [beauvericin co-treated with enniatins] results in increased expression of PGK1 protein CTD PMID:32407736 Pgk1 Rat enzyme inhibitor multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of PGK1 protein CTD PMID:23301498 Pgk1 Rat ethanol increases expression ISO Pgk1 (Mus musculus) 6480464 Ethanol results in increased expression of PGK1 mRNA CTD PMID:19167417 Pgk1 Rat ethanol affects expression ISO Pgk1 (Mus musculus) 6480464 Ethanol affects the expression of PGK1 mRNA CTD PMID:30319688 Pgk1 Rat ethanol affects splicing ISO Pgk1 (Mus musculus) 6480464 Ethanol affects the splicing of PGK1 mRNA CTD PMID:30319688 Pgk1 Rat ethanol decreases expression ISO PGK1 (Homo sapiens) 6480464 Ethanol results in decreased expression of PGK1 mRNA CTD PMID:28986285 Pgk1 Rat ethyl methanesulfonate decreases expression ISO PGK1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of PGK1 mRNA CTD PMID:23649840 Pgk1 Rat fenoldopam increases expression EXP 6480464 Fenoldopam results in increased expression of PGK1 mRNA CTD PMID:21983523 Pgk1 Rat ferric ammonium citrate multiple interactions ISO PGK1 (Homo sapiens) 6480464 ferric ammonium citrate inhibits the reaction [Deferoxamine results in increased expression of PGK1 protein] CTD PMID:19515424 Pgk1 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of PGK1 mRNA CTD PMID:21525395 and PMID:24136188 Pgk1 Rat folic acid affects expression ISO PGK1 (Homo sapiens) 6480464 Folic Acid affects the expression of PGK1 mRNA CTD PMID:17320366 Pgk1 Rat folic acid multiple interactions ISO Pgk1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of PGK1 mRNA CTD PMID:22206623 Pgk1 Rat folic acid decreases expression ISO Pgk1 (Mus musculus) 6480464 Folic Acid results in decreased expression of PGK1 mRNA CTD PMID:25629700 Pgk1 Rat formaldehyde decreases expression ISO PGK1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of PGK1 mRNA CTD PMID:23649840 Pgk1 Rat FR900359 increases phosphorylation ISO PGK1 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of PGK1 protein CTD PMID:37730182 Pgk1 Rat furan affects binding EXP 6480464 furan binds to PGK1 protein CTD PMID:22240984 Pgk1 Rat furfural multiple interactions ISO PGK1 (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Pgk1 Rat genistein increases expression EXP 6480464 Genistein results in increased expression of PGK1 mRNA CTD PMID:12075121 Pgk1 Rat genistein decreases expression ISO PGK1 (Homo sapiens) 6480464 Genistein results in decreased expression of PGK1 mRNA CTD PMID:26865667 Pgk1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of PGK1 mRNA CTD PMID:22061828 Pgk1 Rat glyphosate decreases expression ISO PGK1 (Homo sapiens) 6480464 Glyphosate results in decreased expression of PGK1 mRNA CTD PMID:31295307 Pgk1 Rat glyphosate increases expression ISO Pgk1 (Mus musculus) 6480464 Glyphosate results in increased expression of PGK1 mRNA CTD PMID:36572786 and PMID:36608876 Pgk1 Rat glyphosate multiple interactions EXP 6480464 [azoxystrobin co-treated with 2-chloro-N-(4-chlorobiphenyl-2-yl)nicotinamide co-treated with Chlorpyrifos co-treated with Glyphosate co-treated with imidacloprid co-treated with Thiabendazole] results in decreased expression of PGK1 mRNA CTD PMID:33854195 Pgk1 Rat graphite increases expression ISO PGK1 (Homo sapiens) 6480464 Graphite results in increased expression of PGK1 protein CTD PMID:22157353 Pgk1 Rat haloperidol increases expression EXP 6480464 Haloperidol results in increased expression of PGK1 mRNA CTD PMID:15860345 Pgk1 Rat hyaluronic acid decreases expression EXP 6480464 Hyaluronic Acid analog results in decreased expression of PGK1 protein CTD PMID:23178681 Pgk1 Rat hydrogen peroxide multiple interactions ISO PGK1 (Homo sapiens) 6480464 6-hydroxy-2 more ... CTD PMID:18603805 Pgk1 Rat hydrogen peroxide decreases expression EXP 6480464 Hydrogen Peroxide results in decreased expression of PGK1 protein CTD PMID:23178681 Pgk1 Rat hydrogen peroxide increases expression ISO PGK1 (Homo sapiens) 6480464 Hydrogen Peroxide results in increased expression of PGK1 protein CTD PMID:18603805 Pgk1 Rat imidacloprid multiple interactions EXP 6480464 [azoxystrobin co-treated with 2-chloro-N-(4-chlorobiphenyl-2-yl)nicotinamide co-treated with Chlorpyrifos co-treated with Glyphosate co-treated with imidacloprid co-treated with Thiabendazole] results in decreased expression of PGK1 mRNA CTD PMID:33854195 Pgk1 Rat ivermectin decreases expression ISO PGK1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of PGK1 protein CTD PMID:32959892 Pgk1 Rat L-ascorbic acid decreases expression ISO PGK1 (Homo sapiens) 6480464 Ascorbic Acid results in decreased expression of PGK1 mRNA and Ascorbic Acid results in decreased expression of PGK1 protein CTD PMID:38160894 Pgk1 Rat L-ascorbic acid multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of PGK1 protein more ... CTD PMID:38160894 Pgk1 Rat lithocholic acid increases expression ISO PGK1 (Homo sapiens) 6480464 Lithocholic Acid results in increased expression of PGK1 protein CTD PMID:21224350 Pgk1 Rat manganese atom multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat manganese(0) multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat manganese(II) chloride multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat menadione affects expression ISO PGK1 (Homo sapiens) 6480464 Vitamin K 3 affects the expression of PGK1 mRNA CTD PMID:20044591 Pgk1 Rat methamphetamine decreases expression EXP 6480464 Methamphetamine results in decreased expression of PGK1 protein CTD PMID:19826936 Pgk1 Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of PGK1 mRNA CTD PMID:30047161 Pgk1 Rat methyl methanesulfonate decreases expression ISO PGK1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of PGK1 mRNA CTD PMID:23649840 Pgk1 Rat methylmercury chloride decreases expression ISO PGK1 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of PGK1 mRNA CTD PMID:23179753 and PMID:27188386 Pgk1 Rat metyrapone multiple interactions EXP 6480464 [[Air Pollutants results in increased abundance of Ozone] which co-treated with Metyrapone] results in increased expression of PGK1 mRNA CTD PMID:37088303 Pgk1 Rat miconazole increases expression ISO Pgk1 (Mus musculus) 6480464 Miconazole results in increased expression of PGK1 mRNA CTD PMID:27462272 Pgk1 Rat Monobutylphthalate increases expression ISO Pgk1 (Mus musculus) 6480464 monobutyl phthalate results in increased expression of PGK1 protein CTD PMID:20553848 Pgk1 Rat motexafin gadolinium increases expression ISO PGK1 (Homo sapiens) 6480464 motexafin gadolinium results in increased expression of PGK1 mRNA CTD PMID:16357179 Pgk1 Rat motexafin gadolinium multiple interactions ISO PGK1 (Homo sapiens) 6480464 motexafin gadolinium affects the reaction [Zinc Acetate results in increased expression of PGK1 mRNA] CTD PMID:16357179 Pgk1 Rat Muraglitazar increases expression EXP 6480464 muraglitazar results in increased expression of PGK1 mRNA CTD PMID:21515302 Pgk1 Rat N-methyl-4-phenylpyridinium decreases expression ISO Pgk1 (Mus musculus) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of PGK1 mRNA CTD PMID:17475336 and PMID:22776087 Pgk1 Rat N-methyl-N'-nitro-N-nitrosoguanidine increases expression ISO PGK1 (Homo sapiens) 6480464 Methylnitronitrosoguanidine results in increased expression of PGK1 mRNA CTD PMID:12634122 Pgk1 Rat nickel atom increases expression ISO PGK1 (Homo sapiens) 6480464 Nickel results in increased expression of PGK1 mRNA CTD PMID:25583101 Pgk1 Rat nickel dichloride increases expression EXP 6480464 nickel chloride results in increased expression of PGK1 mRNA CTD PMID:22110744 Pgk1 Rat nickel dichloride increases expression ISO Pgk1 (Mus musculus) 6480464 nickel chloride results in increased expression of PGK1 mRNA CTD PMID:12426141 and PMID:12839937 Pgk1 Rat nickel dichloride increases expression ISO PGK1 (Homo sapiens) 6480464 nickel chloride results in increased expression of PGK1 protein CTD PMID:11250053 Pgk1 Rat nickel dichloride multiple interactions ISO Pgk1 (Mus musculus) 6480464 HIF1A affects the reaction [nickel chloride results in increased expression of PGK1 mRNA] CTD PMID:12426141 Pgk1 Rat nickel sulfate increases expression ISO Pgk1 (Mus musculus) 6480464 nickel sulfate results in increased expression of PGK1 mRNA CTD PMID:16100012 Pgk1 Rat nickel sulfate increases expression ISO PGK1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of PGK1 mRNA CTD PMID:17382205 Pgk1 Rat nickel sulfate affects expression ISO PGK1 (Homo sapiens) 6480464 nickel sulfate affects the expression of PGK1 mRNA CTD PMID:18202158 Pgk1 Rat niclosamide multiple interactions ISO PGK1 (Homo sapiens) 6480464 Niclosamide inhibits the reaction [Oxygen deficiency results in increased expression of PGK1 mRNA] CTD PMID:36318118 Pgk1 Rat nitrates multiple interactions ISO Pgk1 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of PGK1 mRNA CTD PMID:35964746 Pgk1 Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of PGK1 mRNA CTD PMID:33484710 Pgk1 Rat NMN zwitterion multiple interactions ISO Pgk1 (Mus musculus) 6480464 Nicotinamide Mononucleotide inhibits the reaction [Zearalenone results in decreased expression of PGK1 protein] CTD PMID:38159578 Pgk1 Rat Nutlin-3 multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of PGK1 protein CTD PMID:38460933 Pgk1 Rat ochratoxin A decreases expression ISO PGK1 (Homo sapiens) 6480464 ochratoxin A results in decreased expression of PGK1 mRNA CTD PMID:19287073 Pgk1 Rat ozone multiple interactions ISO Pgk1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of PGK1 mRNA CTD PMID:34911549 Pgk1 Rat ozone multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of PGK1 mRNA CTD PMID:35430440 Pgk1 Rat ozone multiple interactions EXP 6480464 [[Air Pollutants results in increased abundance of Ozone] which co-treated with Metyrapone] results in increased expression of PGK1 mRNA and [Air Pollutants results in increased abundance of Ozone] which results in increased expression of PGK1 mRNA CTD PMID:37088303 Pgk1 Rat paracetamol affects expression ISO Pgk1 (Mus musculus) 6480464 Acetaminophen affects the expression of PGK1 mRNA CTD PMID:17562736 Pgk1 Rat paracetamol decreases expression ISO PGK1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of PGK1 mRNA CTD PMID:21420995 Pgk1 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of PGK1 mRNA CTD PMID:32680482 Pgk1 Rat paraquat increases expression ISO PGK1 (Homo sapiens) 6480464 Paraquat results in increased expression of PGK1 protein CTD PMID:34064677 Pgk1 Rat perfluorooctane-1-sulfonic acid affects expression ISO Pgk1 (Mus musculus) 6480464 perfluorooctane sulfonic acid affects the expression of PGK1 mRNA CTD PMID:19429403 Pgk1 Rat perfluorooctanoic acid affects expression ISO Pgk1 (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of PGK1 mRNA CTD PMID:19429403 Pgk1 Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of PGK1 mRNA CTD PMID:35163327 Pgk1 Rat phenobarbital affects expression EXP 6480464 Phenobarbital affects the expression of PGK1 mRNA CTD PMID:16510358 Pgk1 Rat phenobarbital affects expression ISO PGK1 (Homo sapiens) 6480464 Phenobarbital affects the expression of PGK1 mRNA CTD PMID:19159669 Pgk1 Rat phenobarbital increases expression EXP 6480464 Phenobarbital results in increased expression of PGK1 mRNA CTD PMID:19162173 Pgk1 Rat phenylpropanolamine decreases expression ISO Pgk1 (Mus musculus) 6480464 Phenylpropanolamine results in decreased expression of PGK1 mRNA CTD PMID:16465460 Pgk1 Rat potassium dichromate increases expression EXP 6480464 Potassium Dichromate results in increased expression of PGK1 protein CTD PMID:18563748 Pgk1 Rat pregnenolone 16alpha-carbonitrile decreases expression EXP 6480464 Pregnenolone Carbonitrile results in decreased expression of PGK1 mRNA CTD PMID:19162173 Pgk1 Rat prostaglandin A1 increases metabolic processing ISO Pgk1 (Mus musculus) 6480464 prostaglandin A1 analog results in increased metabolism of PGK1 protein CTD PMID:19800325 Pgk1 Rat quartz decreases expression ISO PGK1 (Homo sapiens) 6480464 Quartz results in decreased expression of PGK1 protein CTD PMID:27917503 Pgk1 Rat quercetin increases expression ISO PGK1 (Homo sapiens) 6480464 Quercetin results in increased expression of PGK1 mRNA and Quercetin results in increased expression of PGK1 protein CTD PMID:19207037 and PMID:19729006 Pgk1 Rat quercetin decreases expression ISO PGK1 (Homo sapiens) 6480464 Quercetin results in decreased expression of PGK1 mRNA CTD PMID:21632981 Pgk1 Rat resveratrol increases expression ISO PGK1 (Homo sapiens) 6480464 resveratrol results in increased expression of PGK1 mRNA CTD PMID:15582268 Pgk1 Rat rotenone decreases expression EXP 6480464 Rotenone results in decreased expression of PGK1 mRNA CTD PMID:28374803 Pgk1 Rat Salinomycin decreases expression ISO PGK1 (Homo sapiens) 6480464 salinomycin results in decreased expression of PGK1 mRNA CTD PMID:19682730 Pgk1 Rat silicon dioxide decreases expression ISO PGK1 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of PGK1 mRNA CTD PMID:25895662 Pgk1 Rat silicon dioxide increases secretion ISO PGK1 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased secretion of PGK1 protein CTD PMID:25895662 Pgk1 Rat sodium arsenite increases expression ISO PGK1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of PGK1 mRNA CTD PMID:20886546 more ... Pgk1 Rat sodium arsenite multiple interactions ISO PGK1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PGK1 mRNA CTD PMID:39836092 Pgk1 Rat sodium arsenite affects expression ISO PGK1 (Homo sapiens) 6480464 sodium arsenite affects the expression of PGK1 mRNA CTD PMID:29319823 and PMID:34032870 Pgk1 Rat sodium chloride multiple interactions ISO PGK1 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of PGK1 protein more ... CTD PMID:38598786 Pgk1 Rat sodium fluoride decreases expression EXP 6480464 Sodium Fluoride results in decreased expression of PGK1 protein CTD PMID:29653260 Pgk1 Rat Soman increases expression EXP 6480464 Soman results in increased expression of PGK1 mRNA CTD PMID:19281266 Pgk1 Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of PGK1 mRNA CTD PMID:30047161 Pgk1 Rat sunitinib increases expression ISO PGK1 (Homo sapiens) 6480464 Sunitinib results in increased expression of PGK1 mRNA CTD PMID:31533062 Pgk1 Rat T-2 toxin affects expression EXP 6480464 T-2 Toxin affects the expression of PGK1 protein CTD PMID:26141394 Pgk1 Rat tamoxifen increases expression EXP 6480464 Tamoxifen results in increased expression of PGK1 mRNA CTD PMID:19400957 Pgk1 Rat tamoxifen increases expression ISO Pgk1 (Mus musculus) 6480464 Tamoxifen results in increased expression of PGK1 mRNA CTD PMID:19400957 Pgk1 Rat temozolomide increases expression ISO PGK1 (Homo sapiens) 6480464 Temozolomide results in increased expression of PGK1 mRNA CTD PMID:31758290 Pgk1 Rat Tesaglitazar increases expression EXP 6480464 tesaglitazar results in increased expression of PGK1 mRNA CTD PMID:21515302 Pgk1 Rat tetraethylenepentamine multiple interactions ISO PGK1 (Homo sapiens) 6480464 tetraethylenepentamine inhibits the reaction [cobaltous chloride results in increased expression of PGK1 mRNA] CTD PMID:25100165 Pgk1 Rat thapsigargin decreases expression ISO PGK1 (Homo sapiens) 6480464 Thapsigargin results in decreased expression of PGK1 mRNA CTD PMID:22378314 Pgk1 Rat thapsigargin increases expression EXP 6480464 Thapsigargin results in increased expression of PGK1 protein CTD PMID:35544339 Pgk1 Rat thiabendazole multiple interactions EXP 6480464 [azoxystrobin co-treated with 2-chloro-N-(4-chlorobiphenyl-2-yl)nicotinamide co-treated with Chlorpyrifos co-treated with Glyphosate co-treated with imidacloprid co-treated with Thiabendazole] results in decreased expression of PGK1 mRNA CTD PMID:33854195 Pgk1 Rat thimerosal decreases expression ISO PGK1 (Homo sapiens) 6480464 Thimerosal results in decreased expression of PGK1 mRNA CTD PMID:27188386 Pgk1 Rat thiram decreases expression ISO PGK1 (Homo sapiens) 6480464 Thiram results in decreased expression of PGK1 mRNA CTD PMID:38568856 Pgk1 Rat triadimefon increases expression EXP 6480464 triadimefon results in increased expression of PGK1 mRNA CTD PMID:30047161 Pgk1 Rat trimellitic anhydride increases expression ISO Pgk1 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of PGK1 mRNA CTD PMID:19042947 Pgk1 Rat triphenyl phosphate affects expression ISO PGK1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of PGK1 mRNA CTD PMID:37042841 Pgk1 Rat Triptolide decreases expression ISO Pgk1 (Mus musculus) 6480464 triptolide results in decreased expression of PGK1 mRNA CTD PMID:34087332 Pgk1 Rat Triptolide increases expression ISO Pgk1 (Mus musculus) 6480464 triptolide results in increased expression of PGK1 mRNA CTD PMID:34087332 Pgk1 Rat trovafloxacin decreases expression EXP 6480464 trovafloxacin results in decreased expression of PGK1 mRNA CTD PMID:24136188 Pgk1 Rat tungsten increases expression ISO Pgk1 (Mus musculus) 6480464 Tungsten results in increased expression of PGK1 mRNA CTD PMID:30912803 Pgk1 Rat tunicamycin decreases expression ISO PGK1 (Homo sapiens) 6480464 Tunicamycin results in decreased expression of PGK1 mRNA CTD PMID:22378314 Pgk1 Rat undecane decreases expression EXP 6480464 undecane results in decreased expression of PGK1 protein CTD PMID:17337753 Pgk1 Rat valproic acid increases expression ISO PGK1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of PGK1 mRNA CTD PMID:24383497 and PMID:24935251 Pgk1 Rat valproic acid decreases expression ISO PGK1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of PGK1 mRNA CTD PMID:23179753 and PMID:27188386 Pgk1 Rat vandetanib increases expression ISO PGK1 (Homo sapiens) 6480464 vandetanib results in increased expression of PGK1 mRNA CTD PMID:16052530 Pgk1 Rat vorinostat decreases expression ISO PGK1 (Homo sapiens) 6480464 vorinostat results in decreased expression of PGK1 mRNA CTD PMID:27188386 Pgk1 Rat Yessotoxin increases expression ISO PGK1 (Homo sapiens) 6480464 yessotoxin analog results in increased expression of PGK1 mRNA CTD PMID:30679557 Pgk1 Rat zearalenone decreases expression ISO Pgk1 (Mus musculus) 6480464 Zearalenone results in decreased expression of PGK1 protein CTD PMID:25058043 more ... Pgk1 Rat zearalenone multiple interactions ISO Pgk1 (Mus musculus) 6480464 Nicotinamide Mononucleotide inhibits the reaction [Zearalenone results in decreased expression of PGK1 protein] CTD PMID:38159578 Pgk1 Rat zinc acetate increases expression ISO PGK1 (Homo sapiens) 6480464 Zinc Acetate results in increased expression of PGK1 mRNA CTD PMID:16357179 Pgk1 Rat zinc acetate multiple interactions ISO PGK1 (Homo sapiens) 6480464 motexafin gadolinium affects the reaction [Zinc Acetate results in increased expression of PGK1 mRNA] CTD PMID:16357179 Pgk1 Rat zinc atom increases expression ISO PGK1 (Homo sapiens) 6480464 Zinc results in increased expression of PGK1 mRNA CTD PMID:15226459 Pgk1 Rat zinc dichloride multiple interactions ISO PGK1 (Homo sapiens) 6480464 zinc chloride inhibits the reaction [cobaltous chloride results in increased expression of PGK1 mRNA] CTD PMID:22202117 Pgk1 Rat zinc sulfate increases expression ISO PGK1 (Homo sapiens) 6480464 Zinc Sulfate results in increased expression of PGK1 mRNA CTD PMID:15226459 Pgk1 Rat zinc(0) increases expression ISO PGK1 (Homo sapiens) 6480464 Zinc results in increased expression of PGK1 mRNA CTD PMID:15226459
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(-)-epigallocatechin 3-gallate (ISO) (R,R,R)-alpha-tocopherol (ISO) (Z)-3-butylidenephthalide (ISO) 1,10-phenanthroline (ISO) 1,2,4-trimethylbenzene (EXP) 1,2-dimethylhydrazine (ISO) 1,4-benzoquinone (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-di-tert-butyl-4-methylphenol (ISO) 2,6-dimethoxyphenol (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP,ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 5-chloro-7-iodoquinolin-8-ol (ISO) 6-propyl-2-thiouracil (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-naphthoflavone (ISO) alpha-Zearalanol (EXP) amitrole (EXP) ammonium chloride (EXP) amphetamine (EXP) amphotericin B (ISO) antimycin A (ISO) antirheumatic drug (ISO) aristolochic acid A (ISO) Aroclor 1254 (ISO) arsane (EXP,ISO) arsenic atom (EXP,ISO) arsenite(3-) (ISO) arsenous acid (ISO) Azaspiracid (ISO) azoxystrobin (EXP) beauvericin (ISO) benzatropine (ISO) benzene (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) bromobenzene (EXP) buspirone (EXP) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) cannabidiol (ISO) carbamazepine (ISO) carbon nanotube (ISO) celastrol (ISO) chlorohydrocarbon (EXP) chloropicrin (ISO) chlorpyrifos (EXP) cisplatin (ISO) clobetasol (ISO) clozapine (EXP) cobalt dichloride (EXP,ISO) cobalt(2+) sulfate (ISO) copper atom (ISO) copper(0) (ISO) coumarin (ISO) coumestrol (ISO) cyclosporin A (ISO) decabromodiphenyl ether (EXP) deguelin (ISO) delphinidin (ISO) desferrioxamine B (ISO) dexamethasone (ISO) dextran sulfate (ISO) diallyl trisulfide (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP) dihydroartemisinin (ISO) dimercaprol (ISO) dioxygen (EXP,ISO) diuron (EXP,ISO) dopamine (EXP) doxorubicin (ISO) enniatin (ISO) enzyme inhibitor (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fenoldopam (EXP) ferric ammonium citrate (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) furan (EXP) furfural (ISO) genistein (EXP,ISO) gentamycin (EXP) glyphosate (EXP,ISO) graphite (ISO) haloperidol (EXP) hyaluronic acid (EXP) hydrogen peroxide (EXP,ISO) imidacloprid (EXP) ivermectin (ISO) L-ascorbic acid (ISO) lithocholic acid (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) menadione (ISO) methamphetamine (EXP) methimazole (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) metyrapone (EXP) miconazole (ISO) Monobutylphthalate (ISO) motexafin gadolinium (ISO) Muraglitazar (EXP) N-methyl-4-phenylpyridinium (ISO) N-methyl-N'-nitro-N-nitrosoguanidine (ISO) nickel atom (ISO) nickel dichloride (EXP,ISO) nickel sulfate (ISO) niclosamide (ISO) nitrates (ISO) nitrofen (EXP) NMN zwitterion (ISO) Nutlin-3 (ISO) ochratoxin A (ISO) ozone (EXP,ISO) paracetamol (ISO) paraquat (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP,ISO) phenobarbital (EXP,ISO) phenylpropanolamine (ISO) potassium dichromate (EXP) pregnenolone 16alpha-carbonitrile (EXP) prostaglandin A1 (ISO) quartz (ISO) quercetin (ISO) resveratrol (ISO) rotenone (EXP) Salinomycin (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium chloride (ISO) sodium fluoride (EXP) Soman (EXP) sulfadimethoxine (EXP) sunitinib (ISO) T-2 toxin (EXP) tamoxifen (EXP,ISO) temozolomide (ISO) Tesaglitazar (EXP) tetraethylenepentamine (ISO) thapsigargin (EXP,ISO) thiabendazole (EXP) thimerosal (ISO) thiram (ISO) triadimefon (EXP) trimellitic anhydride (ISO) triphenyl phosphate (ISO) Triptolide (ISO) trovafloxacin (EXP) tungsten (ISO) tunicamycin (ISO) undecane (EXP) valproic acid (ISO) vandetanib (ISO) vorinostat (ISO) Yessotoxin (ISO) zearalenone (ISO) zinc acetate (ISO) zinc atom (ISO) zinc dichloride (ISO) zinc sulfate (ISO) zinc(0) (ISO)
Biological Process
canonical glycolysis (IEA,ISO) cellular response to hypoxia (IEA,ISO) epithelial cell differentiation (IEA,ISO) gluconeogenesis (IBA,IDA,IEA,IMP,ISO) glycolytic process (IBA,IDA,IEA,IMP,ISO) negative regulation of acetyl-CoA biosynthetic process from pyruvate (IEA,ISO) negative regulation of angiogenesis (IEA,ISO) plasminogen activation (IEA,ISO)
Molecular Function
ADP binding (IBA,IDA) ATP binding (IBA,IEA,IMP,ISS) kinase activity (IEA) metal ion binding (IEA) nucleotide binding (IEA) phosphoglycerate kinase activity (IBA,IDA,IEA,IMP,ISO,ISS) protein binding (ISO) protein serine kinase activity (IEA) protein serine/threonine kinase activity (IEA,ISO) protein-disulfide reductase [NAD(P)H] activity (IEA,ISO) transferase activity (IEA) transmembrane transporter binding (IEA)
1.
Key enzymes of carbohydrate metabolism as targets of the 11.5-kDa Zn(2+)-binding protein (parathymosin).
Brand IA and Heinickel A, J Biol Chem. 1991 Nov 5;266(31):20984-9.
2.
Cloning and cDNA sequence of the rat X-chromosome linked phosphoglycerate kinase.
Ciccarese S, etal., Biochem Biophys Res Commun 1989 Dec 29;165(3):1337-44.
3.
Phosphoglycerate kinase deficiency: another cause of recurrent myoglobinuria.
DiMauro S, etal., Ann Neurol. 1983 Jan;13(1):11-9.
4.
The identification of a recurrent phosphoglycerate kinase mutation associated with chronic haemolytic anaemia and neurological dysfunction in a family from USA.
Flanagan JM, etal., Br J Haematol. 2006 Jul;134(2):233-7. Epub 2006 Jun 1.
5.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
6.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
7.
Influence of beta,gamma-methyleneadenosine 5'-triphosphate and 2-phosphoglycerate on rat liver phosphoglycerate kinase.
Lavoinne A Biochimie. 1986 Apr;68(4):569-74.
8.
Kinetic studies of the reaction mechanism of rat liver phosphoglycerate kinase in the direction of ADP utilization.
Lavoinne A, etal., Biochimie. 1983 Mar;65(3):211-20.
9.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
10.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
11.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
12.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
13.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
14.
GOA pipeline
RGD automated data pipeline
15.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
16.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
17.
Monochloroacetic acid inhibits liver gluconeogenesis by inactivating glyceraldehyde-3-phosphate dehydrogenase.
Sakai A, etal., Chem Res Toxicol. 2005 Feb;18(2):277-82.
18.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
Pgk1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 X 75,336,988 - 75,352,962 (+) NCBI GRCr8 mRatBN7.2 X 71,271,454 - 71,287,429 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl X 71,271,440 - 71,287,418 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx X 72,780,371 - 72,796,345 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 X 76,280,383 - 76,296,357 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 X 73,843,195 - 73,859,169 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 X 77,263,399 - 77,279,373 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl X 77,263,359 - 77,279,367 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 X 56,383,459 - 56,399,433 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 X 94,324,219 - 94,340,193 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 X 94,397,574 - 94,413,625 (+) NCBI Celera X 72,583,654 - 72,599,628 (+) NCBI Celera Cytogenetic Map X q22 NCBI
PGK1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 X 78,104,248 - 78,129,295 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl X 77,910,739 - 78,129,295 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 X 77,359,745 - 77,384,792 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 X 77,246,425 - 77,268,980 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 X 77,165,913 - 77,188,467 NCBI Celera X 77,600,747 - 77,623,405 (+) NCBI Celera Cytogenetic Map X q21.1 NCBI HuRef X 70,945,945 - 70,968,603 (+) NCBI HuRef CHM1_1 X 77,252,363 - 77,275,021 (+) NCBI CHM1_1 T2T-CHM13v2.0 X 76,539,329 - 76,564,376 (+) NCBI T2T-CHM13v2.0
Pgk1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 X 105,230,706 - 105,247,305 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl X 105,230,706 - 105,247,305 (+) Ensembl GRCm39 Ensembl GRCm38 X 106,187,100 - 106,203,699 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl X 106,187,100 - 106,203,699 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 X 103,382,463 - 103,399,038 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 X 102,389,843 - 102,406,418 (+) NCBI MGSCv36 mm8 Celera X 93,040,533 - 93,057,028 (+) NCBI Celera Cytogenetic Map X D NCBI cM Map X 47.36 NCBI
Pgk1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955557 1,566,534 - 1,584,799 (+) NCBI ChiLan1.0 ChiLan1.0
PGK1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 X 77,679,278 - 77,701,483 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 X 77,682,484 - 77,708,088 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 X 67,280,269 - 67,302,307 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 X 77,391,639 - 77,413,786 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl X 77,391,805 - 77,414,459 (+) Ensembl panpan1.1 panPan2
PGK1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 X 60,374,743 - 60,396,244 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl X 60,374,754 - 60,423,947 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha X 51,387,842 - 51,409,348 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 X 61,613,473 - 61,634,977 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl X 61,613,477 - 61,690,699 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 X 59,319,607 - 59,341,115 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 X 60,929,381 - 60,951,098 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 X 60,517,684 - 60,539,186 (+) NCBI UU_Cfam_GSD_1.0
Pgk1
PGK1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl X 62,187,434 - 62,210,705 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 X 62,187,472 - 62,210,321 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 X 71,339,754 - 71,351,768 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap X q1.2 NCBI
PGK1
Pgk1
.
Predicted Target Of
Count of predictions: 282 Count of miRNA genes: 186 Interacting mature miRNAs: 211 Transcripts: ENSRNOT00000003390 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61430 Cia18 Collagen induced arthritis QTL 18 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) X 14843113 120568734 Rat 61431 Cia19 Collagen induced arthritis QTL 19 4.4 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) X 65612192 120568734 Rat 738035 Stresp1 Stress response QTL 1 4.96 0.000011 stress-related behavior trait (VT:0010451) defensive burying - coping X 41304447 112935181 Rat 1598837 Memor13 Memory QTL 13 3.2 exploratory behavior trait (VT:0010471) difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) X 41052407 146860749 Rat
AA892797
Rat Assembly Chr Position (strand) Source JBrowse RH 3.4 Map 2 206.3 UniSTS Cytogenetic Map X q31 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000077604 ⟹ ENSRNOP00000073523
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl X 71,271,440 - 71,287,418 (+) Ensembl Rnor_6.0 Ensembl X 77,263,359 - 77,279,367 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000085653 ⟹ ENSRNOP00000073614
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl X 71,277,726 - 71,287,418 (+) Ensembl Rnor_6.0 Ensembl X 77,278,240 - 77,279,367 (+) Ensembl
RefSeq Acc Id:
NM_053291 ⟹ NP_445743
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 X 75,336,988 - 75,352,962 (+) NCBI mRatBN7.2 X 71,271,454 - 71,287,429 (+) NCBI Rnor_6.0 X 77,263,399 - 77,279,373 (+) NCBI Rnor_5.0 X 56,383,459 - 56,399,433 (+) NCBI RGSC_v3.4 X 94,324,219 - 94,340,193 (+) RGD Celera X 72,583,654 - 72,599,628 (+) RGD
Sequence:
CAAAATGTCGCTTTCTAACAAGCTGACTTTGGACAAGCTGGACGTGAAGGGGAAGCGGGTCGTGATGAGGGTGGACTTCAATGTTCCTATGAAGAACAACCAGATAACGAATAACCAAAGGATCAAGG
hide sequence
RefSeq Acc Id:
NP_445743 ⟸ NM_053291
- UniProtKB:
Q5M945 (UniProtKB/Swiss-Prot), Q6P508 (UniProtKB/Swiss-Prot), P16617 (UniProtKB/Swiss-Prot), A6IV43 (UniProtKB/TrEMBL), A0A096MJL6 (UniProtKB/TrEMBL)
- Sequence:
MSLSNKLTLDKLDVKGKRVVMRVDFNVPMKNNQITNNQRIKAAVPSIKFCLDNGAKSVVLMSHLGRPDGVPMPDKYSLEPVAAELKSLLGKDVLFLKDCVGSEVENACANPAAGTVILLENLRFHVEE
hide sequence
Ensembl Acc Id:
ENSRNOP00000073614 ⟸ ENSRNOT00000085653
Ensembl Acc Id:
ENSRNOP00000073523 ⟸ ENSRNOT00000077604
RGD ID: 13701902 Promoter ID: EPDNEW_R12426 Type: initiation region Name: Pgk1_1 Description: phosphoglycerate kinase 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 X 77,263,359 - 77,263,419 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2003-04-09
Pgk1
phosphoglycerate kinase 1
Symbol and Name updated
629477 APPROVED
2003-03-06
Pgk1
phosphoglycerate kinase 1
Pgk
Phosphoglycerate kinase 1
Data merged from RGD:3315
628472 PROVISIONAL
2002-08-07
Pgk1
Symbol and Name status set to provisional
70820 PROVISIONAL
2002-06-10
Pgk
Phosphoglycerate kinase 1
Symbol and Name status set to approved
70586 APPROVED
