Symbol:
Ptk2
Name:
protein tyrosine kinase 2
RGD ID:
3443
Description:
Enables several functions, including identical protein binding activity; integrin binding activity; and phosphatidylinositol 3-kinase binding activity. Involved in several processes, including cellular response to morphine; positive regulation of cell population proliferation; and regulation of cell migration. Located in several cellular components, including basolateral plasma membrane; focal adhesion; and intercalated disc. Is active in glutamatergic synapse and postsynapse. Used to study hepatocellular carcinoma; hypertension; and nephritis. Biomarker of hypertension; ischemia; and uremia. Human ortholog(s) of this gene implicated in leiomyoma; lung small cell carcinoma; and pulmonary hypertension. Orthologous to human PTK2 (protein tyrosine kinase 2); PARTICIPATES IN long term potentiation; integrin mediated signaling pathway; vascular endothelial growth factor signaling pathway; INTERACTS WITH 1-octadec-9-enoylglycero-3-phosphate; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
FADK 1; FAK; focal adhesion kinase; focal adhesion kinase 1; focal adhesion kinase-related nonkinase; FRNK; p125FAK; pp125FAK; Protein tyrosine kinase; protein-tyrosine kinase 2; PTK2 protein tyrosine kinase 2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 107,015,730 - 107,220,865 (-) NCBI GRCr8 mRatBN7.2 7 105,126,725 - 105,331,848 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 105,126,728 - 105,331,783 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 106,875,344 - 107,035,378 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 109,096,927 - 109,256,959 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 109,044,956 - 109,204,985 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 114,436,419 - 114,611,317 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 114,437,361 - 114,590,119 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 114,371,979 - 114,525,553 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 110,933,298 - 111,084,554 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 110,967,527 - 111,118,784 (-) NCBI Celera 7 101,534,957 - 101,690,471 (-) NCBI Celera RH 3.4 Map 7 725.6 RGD Cytogenetic Map 7 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ptk2 Rat (+)-catechin increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Catechin results in increased phosphorylation of PTK2 protein CTD PMID:16038899 Ptk2 Rat (+)-pilocarpine increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Pilocarpine results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat (+)-pilocarpine multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Pilocarpine co-treated with wortmannin] results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat (-)-epigallocatechin 3-gallate decreases phosphorylation ISO Ptk2 (Mus musculus) 6480464 epigallocatechin gallate results in decreased phosphorylation of PTK2 protein CTD PMID:11746506 Ptk2 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO PTK2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of PTK2 mRNA CTD PMID:22079256 Ptk2 Rat (S)-nicotine multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Nicotine co-treated with 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone] results in increased expression of PTK2 protein CTD PMID:30259641 Ptk2 Rat 1,2-dimethylhydrazine multiple interactions ISO Ptk2 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in increased expression of PTK2 mRNA] CTD PMID:22206623 Ptk2 Rat 1,2-dimethylhydrazine increases expression ISO Ptk2 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of PTK2 mRNA CTD PMID:22206623 Ptk2 Rat 1,4-dithiothreitol multiple interactions ISO PTK2 (Homo sapiens) 6480464 Dithiothreitol affects the reaction [4-cresol sulfate affects the localization of PTK2 protein] CTD PMID:31873818 Ptk2 Rat 1,8-cineole multiple interactions ISO Ptk2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of PTK2 protein] and Eucalyptol inhibits the reaction [LEP gene mutant form results in decreased expression of PTK2 protein] CTD PMID:31483951 Ptk2 Rat 1-octadec-9-enoylglycero-3-phosphate increases phosphorylation ISO Ptk2 (Mus musculus) 6480464 lysophosphatidic acid results in increased phosphorylation of PTK2 protein CTD PMID:11792571 Ptk2 Rat 1-octadec-9-enoylglycero-3-phosphate multiple interactions ISO PTK2 (Homo sapiens) 6480464 [wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein more ... CTD PMID:10537051 Ptk2 Rat 1-octadec-9-enoylglycero-3-phosphate multiple interactions EXP 6480464 [wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein and KNG1 protein inhibits the reaction [[wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein] CTD PMID:10537051 Ptk2 Rat 1-octadec-9-enoylglycero-3-phosphate increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 lysophosphatidic acid results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat 1-octadec-9-enoylglycero-3-phosphate increases phosphorylation EXP 6480464 lysophosphatidic acid results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat 17alpha-ethynylestradiol affects expression ISO Ptk2 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of PTK2 mRNA CTD PMID:17555576 Ptk2 Rat 17alpha-ethynylestradiol multiple interactions ISO Ptk2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PTK2 mRNA CTD PMID:17942748 Ptk2 Rat 17beta-estradiol increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Estradiol results in increased phosphorylation of PTK2 protein CTD PMID:12421874 Ptk2 Rat 17beta-estradiol increases expression ISO Ptk2 (Mus musculus) 6480464 Estradiol results in increased expression of PTK2 mRNA CTD PMID:39298647 Ptk2 Rat 17beta-estradiol increases degradation ISO PTK2 (Homo sapiens) 6480464 Estradiol results in increased degradation of PTK2 protein CTD PMID:24440569 Ptk2 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Ptk2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PTK2 mRNA CTD PMID:17942748 Ptk2 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of PTK2 mRNA CTD PMID:33387578 Ptk2 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Ptk2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of PTK2 mRNA CTD PMID:21570461 Ptk2 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of PTK2 mRNA CTD PMID:21346803 Ptk2 Rat 2,6-dimethoxyphenol multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1 and 3-dimethyl ether] results in increased expression of and affects the localization of PTK2 protein CTD PMID:38598786 Ptk2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine multiple interactions EXP 6480464 Puromycin Aminonucleoside results in increased expression of and results in increased phosphorylation of PTK2 protein CTD PMID:14559718 Ptk2 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Ptk2 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of PTK2 mRNA CTD PMID:20188158 Ptk2 Rat 3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione multiple interactions EXP 6480464 bisindolylmaleimide I inhibits the reaction [Isoflurane results in increased phosphorylation of PTK2 protein] and bisindolylmaleimide I inhibits the reaction [Thiopental results in increased phosphorylation of PTK2 protein] CTD PMID:15194624 Ptk2 Rat 3-methylcholanthrene multiple interactions ISO PTK2 (Homo sapiens) 6480464 alpha-naphthoflavone inhibits the reaction [Methylcholanthrene results in decreased phosphorylation of PTK2 protein] CTD PMID:16359657 Ptk2 Rat 3-methylcholanthrene decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Methylcholanthrene results in decreased phosphorylation of PTK2 protein CTD PMID:16359657 Ptk2 Rat 3H-1,2-dithiole-3-thione decreases expression EXP 6480464 1 and 2-dithiol-3-thione results in decreased expression of PTK2 mRNA CTD PMID:19162173 Ptk2 Rat 4,4'-sulfonyldiphenol decreases methylation ISO PTK2 (Homo sapiens) 6480464 bisphenol S results in decreased methylation of PTK2 gene CTD PMID:31601247 Ptk2 Rat 4-(N-nitrosomethylamino)-1-(3-pyridyl)butan-1-one multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Nicotine co-treated with 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone] results in increased expression of PTK2 protein CTD PMID:30259641 Ptk2 Rat 4-hydroxycoumarin decreases phosphorylation ISO Ptk2 (Mus musculus) 6480464 4-hydroxycoumarin results in decreased phosphorylation of PTK2 protein CTD PMID:18492274 Ptk2 Rat 4-hydroxynon-2-enal decreases expression ISO PTK2 (Homo sapiens) 6480464 4-hydroxy-2-nonenal results in decreased expression of PTK2 mRNA CTD PMID:12419474 Ptk2 Rat 4-tert-Octylphenol increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 4-tert-octylphenol results in increased phosphorylation of PTK2 protein CTD PMID:32466334 Ptk2 Rat 5-fluorouracil decreases response to substance ISO PTK2 (Homo sapiens) 6480464 PTK2 protein results in decreased susceptibility to Fluorouracil CTD PMID:16179862 Ptk2 Rat 5-fluorouracil affects expression ISO PTK2 (Homo sapiens) 6480464 Fluorouracil affects the expression of PTK2 mRNA CTD PMID:34151400 Ptk2 Rat 5-fluorouracil decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Fluorouracil results in decreased phosphorylation of PTK2 protein CTD PMID:37625625 Ptk2 Rat 8-Br-cAMP multiple interactions ISO Ptk2 (Mus musculus) 6480464 8-Bromo Cyclic Adenosine Monophosphate inhibits the reaction [HU 211 results in increased phosphorylation of PTK2 protein] CTD PMID:12163181 Ptk2 Rat acrylamide increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Acrylamide results in increased phosphorylation of PTK2 protein CTD PMID:11478917 and PMID:18215454 Ptk2 Rat acrylamide decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Acrylamide results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat acrylamide multiple interactions ISO PTK2 (Homo sapiens) 6480464 2-cyclopentyl-5-(5-isoquinolylsulfonyl)-6-nitro-1H-benzo(D)imidazole inhibits the reaction [Acrylamide results in increased phosphorylation of PTK2 protein] CTD PMID:11478917 Ptk2 Rat actinomycin D decreases expression EXP 6480464 Dactinomycin results in decreased expression of PTK2 protein CTD PMID:15959627 Ptk2 Rat aflatoxin B1 increases methylation ISO PTK2 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of PTK2 gene CTD PMID:27153756 Ptk2 Rat aflatoxin B1 decreases expression ISO PTK2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of PTK2 mRNA CTD PMID:28943387 Ptk2 Rat aldehydo-D-glucose multiple interactions ISO Ptk2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of PTK2 protein] and Glucose inhibits the reaction [IL1B protein results in increased phosphorylation of PTK2 protein] CTD PMID:30098273 and PMID:31483951 Ptk2 Rat aldehydo-D-glucose multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Glucose deficiency] results in decreased phosphorylation of PTK2 protein more ... CTD PMID:15194624 Ptk2 Rat aldehydo-D-glucose decreases expression ISO Ptk2 (Mus musculus) 6480464 Glucose results in decreased expression of PTK2 protein CTD PMID:31483951 Ptk2 Rat aldehydo-D-glucose decreases expression ISO PTK2 (Homo sapiens) 6480464 Glucose results in decreased expression of PTK2 mRNA CTD PMID:31655124 Ptk2 Rat all-trans-retinoic acid multiple interactions ISO PTK2 (Homo sapiens) 6480464 PTK2 protein inhibits the reaction [Tretinoin promotes the reaction [CEBPA protein binds to RB1 protein]] more ... CTD PMID:16226872 Ptk2 Rat all-trans-retinoic acid decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Tretinoin results in decreased phosphorylation of PTK2 protein CTD PMID:38251951 Ptk2 Rat all-trans-retinoic acid increases expression ISO PTK2 (Homo sapiens) 6480464 Tretinoin results in increased expression of PTK2 mRNA CTD PMID:17045167 Ptk2 Rat all-trans-retinoic acid increases cleavage ISO PTK2 (Homo sapiens) 6480464 Tretinoin results in increased cleavage of PTK2 protein CTD PMID:11369141 Ptk2 Rat all-trans-retinoic acid decreases response to substance ISO PTK2 (Homo sapiens) 6480464 PTK2 protein results in decreased susceptibility to Tretinoin CTD PMID:16226872 Ptk2 Rat alpha-naphthoflavone multiple interactions ISO PTK2 (Homo sapiens) 6480464 alpha-naphthoflavone inhibits the reaction [Methylcholanthrene results in decreased phosphorylation of PTK2 protein] CTD PMID:16359657 Ptk2 Rat aluminium oxide multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Aluminum Oxide co-treated with Magnesium] results in increased expression of PTK2 protein CTD PMID:12209937 Ptk2 Rat AM-251 multiple interactions ISO PTK2 (Homo sapiens) 6480464 [AM 251 co-treated with iodopravadoline] inhibits the reaction [Dronabinol results in increased phosphorylation of PTK2 protein] CTD PMID:31461164 Ptk2 Rat ammonium chloride decreases expression EXP 6480464 Ammonium Chloride results in decreased expression of PTK2 protein CTD PMID:16483693 Ptk2 Rat ammonium chloride multiple interactions ISO PTK2 (Homo sapiens) 6480464 Ammonium Chloride inhibits the reaction [cordycepin results in decreased expression of PTK2 protein] CTD PMID:28068557 Ptk2 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PTK2 mRNA CTD PMID:16483693 Ptk2 Rat amosite asbestos increases activity ISO Ptk2 (Mus musculus) 6480464 Asbestos and Amosite results in increased activity of PTK2 protein CTD PMID:29112861 Ptk2 Rat Anetholtrithion multiple interactions ISO PTK2 (Homo sapiens) 6480464 Anethole Trithione inhibits the reaction [Reactive Oxygen Species results in increased phosphorylation of PTK2 protein] CTD PMID:11213483 Ptk2 Rat antirheumatic drug increases expression ISO PTK2 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of PTK2 mRNA CTD PMID:24449571 Ptk2 Rat aristolochic acid A decreases expression ISO PTK2 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of PTK2 mRNA CTD PMID:33212167 Ptk2 Rat aristolochic acid A increases phosphorylation ISO Ptk2 (Mus musculus) 6480464 aristolochic acid I results in increased phosphorylation of PTK2 protein CTD PMID:39426658 Ptk2 Rat aristolochic acid A multiple interactions ISO Ptk2 (Mus musculus) 6480464 AG 1879 inhibits the reaction [aristolochic acid I results in increased phosphorylation of PTK2 protein] and MitoTEMPO inhibits the reaction [aristolochic acid I results in increased phosphorylation of PTK2 protein] CTD PMID:39426658 Ptk2 Rat arsane decreases phosphorylation EXP 6480464 Arsenic results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat arsane increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Arsenic results in increased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat arsane decreases expression ISO PTK2 (Homo sapiens) 6480464 Arsenic results in decreased expression of PTK2 protein CTD PMID:16420308 Ptk2 Rat arsenic atom increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Arsenic results in increased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat arsenic atom decreases expression ISO PTK2 (Homo sapiens) 6480464 Arsenic results in decreased expression of PTK2 protein CTD PMID:16420308 Ptk2 Rat arsenic atom decreases phosphorylation EXP 6480464 Arsenic results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat arsenite(3-) increases expression ISO Ptk2 (Mus musculus) 6480464 arsenite results in increased expression of PTK2 protein CTD PMID:37955338 Ptk2 Rat arsenite(3-) multiple interactions ISO PTK2 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to PTK2 mRNA] CTD PMID:32406909 Ptk2 Rat atrazine multiple interactions ISO PTK2 (Homo sapiens) 6480464 Atrazine inhibits the reaction [Tetradecanoylphorbol Acetate results in increased phosphorylation of PTK2 protein] CTD PMID:24211529 Ptk2 Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of PTK2 gene CTD PMID:35440735 Ptk2 Rat atropine multiple interactions ISO PTK2 (Homo sapiens) 6480464 Atropine inhibits the reaction [oxotremorine M inhibits the reaction [[wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein]] more ... CTD PMID:10537051 Ptk2 Rat barium(0) increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Barium results in increased phosphorylation of PTK2 protein CTD PMID:23804419 Ptk2 Rat benzene decreases expression ISO PTK2 (Homo sapiens) 6480464 Benzene results in decreased expression of PTK2 mRNA CTD PMID:33064461 Ptk2 Rat benzo[a]pyrene increases expression ISO Ptk2 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of PTK2 mRNA CTD PMID:22228805 Ptk2 Rat benzo[a]pyrene affects methylation ISO PTK2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PTK2 5' UTR and Benzo(a)pyrene affects the methylation of PTK2 intron CTD PMID:27901495 and PMID:30157460 Ptk2 Rat benzo[a]pyrene decreases expression ISO PTK2 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of PTK2 mRNA CTD PMID:20064835 more ... Ptk2 Rat benzo[a]pyrene diol epoxide I decreases expression ISO PTK2 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 and PMID:28529061 Ptk2 Rat beta-lapachone increases expression ISO PTK2 (Homo sapiens) 6480464 beta-lapachone results in increased expression of PTK2 mRNA CTD PMID:38218311 Ptk2 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PTK2 mRNA CTD PMID:25181051 Ptk2 Rat bisphenol A multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat bisphenol A multiple interactions ISO PTK2 (Homo sapiens) 6480464 [RTKI cpd co-treated with bisphenol A] results in increased phosphorylation of PTK2 protein and GPER1 protein affects the reaction [bisphenol A results in increased phosphorylation of PTK2 protein] CTD PMID:32325111 Ptk2 Rat bisphenol A increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 bisphenol A results in increased phosphorylation of PTK2 protein CTD PMID:31143956 more ... Ptk2 Rat bisphenol F multiple interactions ISO PTK2 (Homo sapiens) 6480464 [bisphenol F co-treated with Fulvestrant] results in decreased methylation of PTK2 gene CTD PMID:31601247 Ptk2 Rat blebbistatin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 blebbistatin results in decreased phosphorylation of PTK2 protein CTD PMID:18718759 Ptk2 Rat BQ 123 multiple interactions ISO PTK2 (Homo sapiens) 6480464 [BQ 788 co-treated with cyclo(Trp-Asp-Pro-Val-Leu)] inhibits the reaction [EDN1 protein results in increased phosphorylation of PTK2 protein] CTD PMID:12875994 Ptk2 Rat bufalin decreases expression ISO PTK2 (Homo sapiens) 6480464 bufalin results in decreased expression of PTK2 protein CTD PMID:23949904 Ptk2 Rat Butylbenzyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat cadmium atom multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of PTK2 mRNA CTD PMID:35301059 Ptk2 Rat cadmium dichloride multiple interactions ISO Ptk2 (Mus musculus) 6480464 Cadmium Chloride results in decreased expression of and results in increased phosphorylation of PTK2 protein CTD PMID:28830677 Ptk2 Rat cadmium dichloride increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Cadmium Chloride results in increased phosphorylation of PTK2 protein CTD PMID:28527916 Ptk2 Rat cadmium dichloride multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of PTK2 mRNA more ... CTD PMID:28830677 and PMID:35301059 Ptk2 Rat caffeine affects phosphorylation ISO PTK2 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of PTK2 protein CTD PMID:35688186 Ptk2 Rat calyculin a multiple interactions ISO PTK2 (Homo sapiens) 6480464 calyculin A inhibits the reaction [cordycepin results in decreased phosphorylation of PTK2 protein] CTD PMID:28068557 Ptk2 Rat cannabidiol decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Cannabidiol results in decreased phosphorylation of PTK2 protein CTD PMID:37625625 Ptk2 Rat capsaicin multiple interactions ISO PTK2 (Homo sapiens) 6480464 Capsaicin inhibits the reaction [EGF results in increased phosphorylation of PTK2 protein] CTD PMID:21462327 Ptk2 Rat carbamazepine affects expression ISO PTK2 (Homo sapiens) 6480464 Carbamazepine affects the expression of PTK2 mRNA CTD PMID:24752500 and PMID:25979313 Ptk2 Rat carbamazepine decreases activity ISO PTK2 (Homo sapiens) 6480464 Carbamazepine results in decreased activity of PTK2 protein CTD PMID:24352538 Ptk2 Rat carbon nanotube affects expression ISO Ptk2 (Mus musculus) 6480464 Nanotubes and Carbon affects the expression of PTK2 mRNA CTD PMID:23845593 Ptk2 Rat carbon nanotube increases activity ISO Ptk2 (Mus musculus) 6480464 Nanotubes and Carbon results in increased activity of PTK2 protein CTD PMID:29112861 Ptk2 Rat carbon nanotube decreases expression ISO Ptk2 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Ptk2 Rat carvone decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 carvone results in decreased phosphorylation of PTK2 protein CTD PMID:37059214 Ptk2 Rat casticin decreases expression ISO Ptk2 (Mus musculus) 6480464 casticin results in decreased expression of PTK2 protein CTD PMID:28444820 Ptk2 Rat CGP 52608 multiple interactions ISO PTK2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to PTK2 gene] CTD PMID:28238834 Ptk2 Rat chelerythrine multiple interactions EXP 6480464 chelerythrine inhibits the reaction [Isoflurane results in increased phosphorylation of PTK2 protein] and chelerythrine inhibits the reaction [Thiopental results in increased phosphorylation of PTK2 protein] CTD PMID:15194624 Ptk2 Rat chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of PTK2 mRNA CTD PMID:20691718 Ptk2 Rat chromium(6+) multiple interactions ISO PTK2 (Homo sapiens) 6480464 Luteolin inhibits the reaction [chromium hexavalent ion results in increased phosphorylation of PTK2 protein] CTD PMID:25448439 Ptk2 Rat chromium(6+) increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 chromium hexavalent ion results in increased phosphorylation of PTK2 protein CTD PMID:25448439 Ptk2 Rat chrysin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 chrysin results in decreased phosphorylation of PTK2 protein CTD PMID:30578657 Ptk2 Rat cisplatin decreases expression EXP 6480464 Cisplatin results in decreased expression of PTK2 protein modified form CTD PMID:23628706 Ptk2 Rat cisplatin decreases expression ISO PTK2 (Homo sapiens) 6480464 Cisplatin results in decreased expression of PTK2 mRNA and Cisplatin results in decreased expression of PTK2 protein CTD PMID:16391810 more ... Ptk2 Rat cisplatin decreases expression ISO Ptk2 (Mus musculus) 6480464 Cisplatin results in decreased expression of PTK2 protein modified form CTD PMID:23628706 Ptk2 Rat clozapine increases expression ISO PTK2 (Homo sapiens) 6480464 Clozapine results in increased expression of PTK2 protein CTD PMID:34122009 Ptk2 Rat cocaine decreases expression ISO PTK2 (Homo sapiens) 6480464 Cocaine results in decreased expression of PTK2 mRNA CTD PMID:12629581 Ptk2 Rat cocaine decreases phosphorylation ISO Ptk2 (Mus musculus) 6480464 Cocaine results in decreased phosphorylation of PTK2 protein CTD PMID:27506785 Ptk2 Rat copper atom multiple interactions EXP 6480464 [Copper deficiency co-treated with tetrathiomolybdate] results in decreased phosphorylation of PTK2 protein CTD PMID:22276220 Ptk2 Rat copper atom multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of PTK2 mRNA CTD PMID:30911355 Ptk2 Rat copper(0) multiple interactions EXP 6480464 [Copper deficiency co-treated with tetrathiomolybdate] results in decreased phosphorylation of PTK2 protein CTD PMID:22276220 Ptk2 Rat copper(0) multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of PTK2 mRNA CTD PMID:30911355 Ptk2 Rat cordycepin multiple interactions ISO PTK2 (Homo sapiens) 6480464 Ammonium Chloride inhibits the reaction [cordycepin results in decreased expression of PTK2 protein] more ... CTD PMID:28068557 Ptk2 Rat cordycepin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 cordycepin results in decreased phosphorylation of PTK2 protein CTD PMID:36299321 Ptk2 Rat crocidolite asbestos decreases expression ISO Ptk2 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of PTK2 mRNA CTD PMID:29279043 Ptk2 Rat cyclosporin A decreases methylation ISO PTK2 (Homo sapiens) 6480464 Cyclosporine results in decreased methylation of PTK2 promoter CTD PMID:27989131 Ptk2 Rat D-glucose multiple interactions ISO Ptk2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of PTK2 protein] and Glucose inhibits the reaction [IL1B protein results in increased phosphorylation of PTK2 protein] CTD PMID:30098273 and PMID:31483951 Ptk2 Rat D-glucose multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Glucose deficiency] results in decreased phosphorylation of PTK2 protein more ... CTD PMID:15194624 Ptk2 Rat D-glucose decreases expression ISO Ptk2 (Mus musculus) 6480464 Glucose results in decreased expression of PTK2 protein CTD PMID:31483951 Ptk2 Rat D-glucose decreases expression ISO PTK2 (Homo sapiens) 6480464 Glucose results in decreased expression of PTK2 mRNA CTD PMID:31655124 Ptk2 Rat D-mannitol multiple interactions ISO PTK2 (Homo sapiens) 6480464 benzyloxycarbonyl-valyl-alanyl-aspartic acid inhibits the reaction [Mannitol results in decreased phosphorylation of and results in increased degradation of PTK2 protein] and Mannitol results in decreased phosphorylation of and results in increased degradation of PTK2 protein CTD PMID:12011046 Ptk2 Rat daidzein increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 daidzein results in increased phosphorylation of PTK2 protein CTD PMID:12421874 Ptk2 Rat deguelin decreases expression ISO PTK2 (Homo sapiens) 6480464 deguelin results in decreased expression of PTK2 protein CTD PMID:25322282 Ptk2 Rat deguelin increases expression ISO PTK2 (Homo sapiens) 6480464 deguelin results in increased expression of PTK2 mRNA CTD PMID:33512557 Ptk2 Rat Di-n-octyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat diallyl trisulfide decreases expression ISO PTK2 (Homo sapiens) 6480464 diallyl trisulfide results in decreased expression of PTK2 protein and diallyl trisulfide results in decreased expression of PTK2 protein modified form CTD PMID:28741790 Ptk2 Rat dibenzo[a,l]pyrene decreases expression ISO PTK2 (Homo sapiens) 6480464 dibenzo(a and l)pyrene results in decreased expression of PTK2 mRNA CTD PMID:16269432 Ptk2 Rat Dibutyl phosphate affects expression ISO PTK2 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of PTK2 mRNA CTD PMID:37042841 Ptk2 Rat dibutyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat diclofenac affects expression ISO PTK2 (Homo sapiens) 6480464 Diclofenac affects the expression of PTK2 mRNA CTD PMID:24752500 Ptk2 Rat Dictamnine decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 dictamnine results in decreased phosphorylation of PTK2 protein CTD PMID:34861243 Ptk2 Rat diethyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat Diisodecyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat diisononyl phthalate multiple interactions ISO Ptk2 (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate co-treated with diethyl phthalate co-treated with diisononyl phthalate co-treated with di-n-octyl phthalate co-treated with Dibutyl Phthalate co-treated with butylbenzyl phthalate co-treated with diisodecyl phthalate] results in decreased expression of PTK2 protein CTD PMID:37364641 Ptk2 Rat dioscin multiple interactions ISO PTK2 (Homo sapiens) 6480464 dioscin inhibits the reaction [VEGFA protein results in increased phosphorylation of PTK2 protein] CTD PMID:25111127 Ptk2 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Glucose deficiency] results in decreased phosphorylation of PTK2 protein more ... CTD PMID:15194624 Ptk2 Rat disodium selenite multiple interactions ISO PTK2 (Homo sapiens) 6480464 Sodium Selenite results in increased phosphorylation of and results in increased activity of PTK2 protein CTD PMID:12896980 Ptk2 Rat dorsomorphin multiple interactions ISO PTK2 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Ptk2 Rat doxazosin decreases expression ISO PTK2 (Homo sapiens) 6480464 Doxazosin results in decreased expression of PTK2 protein CTD PMID:15221243 Ptk2 Rat doxazosin increases cleavage ISO Ptk2 (Mus musculus) 6480464 Doxazosin results in increased cleavage of PTK2 protein CTD PMID:22845314 Ptk2 Rat doxorubicin multiple interactions ISO PTK2 (Homo sapiens) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [PTK2 protein promotes the reaction [Doxorubicin results in increased phosphorylation of AKT1 protein]] and PTK2 protein promotes the reaction [Doxorubicin results in increased phosphorylation of AKT1 protein] CTD PMID:16168102 Ptk2 Rat doxorubicin decreases phosphorylation EXP 6480464 Doxorubicin results in decreased phosphorylation of PTK2 protein CTD PMID:16825486 Ptk2 Rat doxorubicin affects cleavage ISO PTK2 (Homo sapiens) 6480464 Doxorubicin affects the cleavage of PTK2 protein CTD PMID:15870702 Ptk2 Rat emodin affects expression EXP 6480464 Emodin affects the expression of PTK2 protein CTD PMID:19549930 Ptk2 Rat endosulfan increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Endosulfan results in increased phosphorylation of PTK2 protein CTD PMID:22677888 and PMID:32044604 Ptk2 Rat endosulfan decreases expression ISO PTK2 (Homo sapiens) 6480464 Endosulfan results in decreased expression of PTK2 protein and Endosulfan results in decreased expression of PTK2 protein modified form CTD PMID:28108160 Ptk2 Rat ethanol multiple interactions ISO PTK2 (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in decreased expression of PTK2 mRNA CTD PMID:29432896 Ptk2 Rat ethanol affects splicing ISO Ptk2 (Mus musculus) 6480464 Ethanol affects the splicing of PTK2 mRNA CTD PMID:30319688 Ptk2 Rat ethyl methanesulfonate decreases expression ISO PTK2 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of PTK2 mRNA CTD PMID:23649840 Ptk2 Rat everolimus decreases expression ISO PTK2 (Homo sapiens) 6480464 Everolimus results in decreased expression of PTK2 protein modified form CTD PMID:28258630 Ptk2 Rat fenthion decreases expression ISO Ptk2 (Mus musculus) 6480464 Fenthion results in decreased expression of PTK2 mRNA CTD PMID:34813904 Ptk2 Rat flavonoids increases expression EXP 6480464 Flavonoids results in increased expression of PTK2 mRNA CTD PMID:18035473 Ptk2 Rat flavonol decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 3-hydroxyflavone results in decreased phosphorylation of PTK2 protein CTD PMID:27600294 Ptk2 Rat flubendazole decreases expression ISO PTK2 (Homo sapiens) 6480464 flubendazole results in decreased expression of PTK2 protein CTD PMID:30075109 Ptk2 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of PTK2 mRNA CTD PMID:24136188 Ptk2 Rat folic acid multiple interactions ISO Ptk2 (Mus musculus) 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in increased expression of PTK2 mRNA] CTD PMID:22206623 Ptk2 Rat formaldehyde decreases expression ISO PTK2 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of PTK2 mRNA CTD PMID:23649840 Ptk2 Rat fulvestrant increases degradation ISO PTK2 (Homo sapiens) 6480464 fulvestrant results in increased degradation of PTK2 protein CTD PMID:24440569 Ptk2 Rat fulvestrant multiple interactions ISO PTK2 (Homo sapiens) 6480464 [bisphenol F co-treated with Fulvestrant] results in decreased methylation of PTK2 gene CTD PMID:31601247 Ptk2 Rat furfural multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of PTK2 protein CTD PMID:38598786 Ptk2 Rat gadolinium trichloride increases activity ISO PTK2 (Homo sapiens) 6480464 gadolinium chloride results in increased activity of PTK2 CTD PMID:19184457 Ptk2 Rat gallic acid decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Gallic Acid results in decreased phosphorylation of PTK2 protein CTD PMID:38100242 Ptk2 Rat Garcinol decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 garcinol results in decreased phosphorylation of PTK2 protein CTD PMID:16052481 Ptk2 Rat geldanamycin increases degradation ISO PTK2 (Homo sapiens) 6480464 geldanamycin results in increased degradation of PTK2 protein CTD PMID:9973544 Ptk2 Rat geldanamycin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 geldanamycin results in decreased phosphorylation of PTK2 protein CTD PMID:12811834 Ptk2 Rat geldanamycin increases degradation ISO Ptk2 (Mus musculus) 6480464 geldanamycin results in increased degradation of PTK2 protein CTD PMID:9973544 Ptk2 Rat gemcitabine decreases response to substance ISO PTK2 (Homo sapiens) 6480464 PTK2 protein results in decreased susceptibility to Gemcitabine CTD PMID:14623342 Ptk2 Rat genistein increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Genistein results in increased phosphorylation of PTK2 protein CTD PMID:12421874 Ptk2 Rat Geraniin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Geraniin results in decreased phosphorylation of PTK2 protein CTD PMID:31184425 Ptk2 Rat glucose decreases expression ISO PTK2 (Homo sapiens) 6480464 Glucose results in decreased expression of PTK2 mRNA CTD PMID:31655124 Ptk2 Rat glucose multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Glucose deficiency] results in decreased phosphorylation of PTK2 protein more ... CTD PMID:15194624 Ptk2 Rat glucose decreases expression ISO Ptk2 (Mus musculus) 6480464 Glucose results in decreased expression of PTK2 protein CTD PMID:31483951 Ptk2 Rat glucose multiple interactions ISO Ptk2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of PTK2 protein] and Glucose inhibits the reaction [IL1B protein results in increased phosphorylation of PTK2 protein] CTD PMID:30098273 and PMID:31483951 Ptk2 Rat halothane decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Halothane results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat heparin decreases phosphorylation ISO Ptk2 (Mus musculus) 6480464 Heparin results in decreased phosphorylation of PTK2 protein CTD PMID:18674534 Ptk2 Rat hyaluronic acid multiple interactions EXP 6480464 Hyaluronic Acid analog inhibits the reaction [Hydrogen Peroxide results in decreased phosphorylation of PTK2 protein] CTD PMID:23178681 Ptk2 Rat hydrogen peroxide affects expression ISO PTK2 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of PTK2 mRNA CTD PMID:20044591 Ptk2 Rat hydrogen peroxide multiple interactions EXP 6480464 Hyaluronic Acid analog inhibits the reaction [Hydrogen Peroxide results in decreased phosphorylation of PTK2 protein] CTD PMID:23178681 Ptk2 Rat hydrogen peroxide decreases phosphorylation EXP 6480464 Hydrogen Peroxide results in decreased phosphorylation of PTK2 protein CTD PMID:23178681 Ptk2 Rat hydrogen peroxide increases cleavage ISO PTK2 (Homo sapiens) 6480464 Hydrogen Peroxide results in increased cleavage of PTK2 protein CTD PMID:17888894 Ptk2 Rat hydrogen peroxide multiple interactions ISO PTK2 (Homo sapiens) 6480464 benzyloxycarbonyl-valyl-alanyl-aspartic acid analog inhibits the reaction [Hydrogen Peroxide results in increased cleavage of PTK2 protein] CTD PMID:17888894 Ptk2 Rat indometacin affects localization ISO PTK2 (Homo sapiens) 6480464 Indomethacin affects the localization of PTK2 protein CTD PMID:12037131 Ptk2 Rat indometacin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Indomethacin results in decreased phosphorylation of PTK2 protein CTD PMID:12037131 Ptk2 Rat indometacin multiple interactions ISO PTK2 (Homo sapiens) 6480464 Indomethacin inhibits the reaction [EGF protein affects the localization of PTK2 protein] and Indomethacin inhibits the reaction [EGF protein results in increased phosphorylation of PTK2 protein] CTD PMID:12037131 Ptk2 Rat irinotecan decreases expression ISO PTK2 (Homo sapiens) 6480464 Irinotecan analog results in decreased expression of PTK2 mRNA CTD PMID:18927307 Ptk2 Rat isoflurane increases phosphorylation EXP 6480464 Isoflurane results in increased phosphorylation of PTK2 protein CTD PMID:15194624 Ptk2 Rat isoflurane multiple interactions EXP 6480464 bisindolylmaleimide I inhibits the reaction [Isoflurane results in increased phosphorylation of PTK2 protein] more ... CTD PMID:15194624 Ptk2 Rat ivermectin decreases expression ISO PTK2 (Homo sapiens) 6480464 Ivermectin results in decreased expression of PTK2 protein CTD PMID:32959892 Ptk2 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of PTK2 mRNA CTD PMID:20080153 Ptk2 Rat L-1,4-dithiothreitol multiple interactions ISO PTK2 (Homo sapiens) 6480464 Dithiothreitol affects the reaction [4-cresol sulfate affects the localization of PTK2 protein] CTD PMID:31873818 Ptk2 Rat L-ascorbic acid decreases expression EXP 6480464 Ascorbic Acid results in decreased expression of PTK2 mRNA CTD PMID:15372504 Ptk2 Rat lead(0) decreases phosphorylation EXP 6480464 Lead results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat lead(0) affects splicing ISO PTK2 (Homo sapiens) 6480464 Lead affects the splicing of PTK2 mRNA CTD PMID:28903495 Ptk2 Rat lipopolysaccharide increases phosphorylation ISO Ptk2 (Mus musculus) 6480464 Lipopolysaccharides results in increased phosphorylation of PTK2 protein CTD PMID:21125213 Ptk2 Rat lithocholic acid multiple interactions ISO PTK2 (Homo sapiens) 6480464 Lithocholic Acid results in decreased phosphorylation of and results in decreased activity of PTK2 protein CTD PMID:21224350 Ptk2 Rat luteolin multiple interactions ISO PTK2 (Homo sapiens) 6480464 EGF protein inhibits the reaction [Luteolin results in decreased phosphorylation of PTK2 protein] more ... CTD PMID:15135307 and PMID:25448439 Ptk2 Rat luteolin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Luteolin results in decreased phosphorylation of PTK2 protein CTD PMID:15135307 Ptk2 Rat LY294002 multiple interactions ISO PTK2 (Homo sapiens) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [EGF protein results in increased phosphorylation of PTK2 protein] and 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [PTK2 protein promotes the reaction [Doxorubicin results in increased phosphorylation of AKT1 protein]] CTD PMID:16168102 and PMID:26109002 Ptk2 Rat magnesium atom multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Aluminum Oxide co-treated with Magnesium] results in increased expression of PTK2 protein CTD PMID:12209937 Ptk2 Rat mebendazole decreases expression ISO PTK2 (Homo sapiens) 6480464 Mebendazole results in decreased expression of PTK2 protein CTD PMID:30075109 Ptk2 Rat methidathion decreases expression ISO Ptk2 (Mus musculus) 6480464 methidathion results in decreased expression of PTK2 mRNA CTD PMID:34813904 Ptk2 Rat methyl methanesulfonate decreases expression ISO PTK2 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of PTK2 mRNA CTD PMID:23649840 Ptk2 Rat methylisothiazolinone decreases phosphorylation EXP 6480464 2-methyl-4-isothiazolin-3-one results in decreased phosphorylation of PTK2 protein CTD PMID:18215454 Ptk2 Rat methylmercury chloride decreases expression ISO PTK2 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of PTK2 mRNA CTD PMID:26272509 and PMID:28001369 Ptk2 Rat microcystin-LR decreases expression EXP 6480464 cyanoginosin LR results in decreased expression of PTK2 mRNA CTD PMID:36657700 Ptk2 Rat mifepristone multiple interactions EXP 6480464 Mifepristone inhibits the reaction [Progesterone results in increased expression of PTK2 protein] CTD PMID:20959644 Ptk2 Rat MitoTEMPO multiple interactions ISO Ptk2 (Mus musculus) 6480464 MitoTEMPO inhibits the reaction [aristolochic acid I results in increased phosphorylation of PTK2 protein] CTD PMID:39426658 Ptk2 Rat ML-7 decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 ML 7 results in decreased phosphorylation of PTK2 protein CTD PMID:18718759 Ptk2 Rat morphine decreases phosphorylation EXP 401959321 morphine decreases phosphorylation of Ptk2 in rat ventral tegmental area neurons RGD Ptk2 Rat N(4)-hydroxycytidine decreases expression ISO Ptk2 (Mus musculus) 6480464 N(4)-hydroxycytidine results in decreased expression of PTK2 mRNA CTD PMID:37748715 Ptk2 Rat N-acetyl-L-cysteine multiple interactions ISO PTK2 (Homo sapiens) 6480464 Acetylcysteine inhibits the reaction [[[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein] CTD PMID:17888894 Ptk2 Rat nickel dichloride increases expression ISO Ptk2 (Mus musculus) 6480464 nickel chloride results in increased expression of PTK2 mRNA CTD PMID:12839937 Ptk2 Rat nickel dichloride multiple interactions ISO Ptk2 (Mus musculus) 6480464 HIF1A affects the reaction [nickel chloride results in increased expression of PTK2 mRNA] CTD PMID:12729255 Ptk2 Rat nicotine multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Nicotine co-treated with 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone] results in increased expression of PTK2 protein CTD PMID:30259641 Ptk2 Rat nitric oxide decreases expression ISO Ptk2 (Mus musculus) 6480464 Nitric Oxide deficiency results in decreased expression of PTK2 mRNA CTD PMID:15878706 Ptk2 Rat ochratoxin A increases expression ISO PTK2 (Homo sapiens) 6480464 ochratoxin A metabolite results in increased expression of PTK2 mRNA and ochratoxin A results in increased expression of PTK2 mRNA CTD PMID:26314263 Ptk2 Rat Octicizer decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 2-ethylhexyldiphenylphosphate results in decreased phosphorylation of PTK2 protein CTD PMID:37027338 Ptk2 Rat okadaic acid multiple interactions ISO PTK2 (Homo sapiens) 6480464 Okadaic Acid inhibits the reaction [cordycepin results in decreased phosphorylation of PTK2 protein] CTD PMID:28068557 Ptk2 Rat Ophiopogonin D multiple interactions ISO PTK2 (Homo sapiens) 6480464 ITGB1 protein inhibits the reaction [ophiopogonin D inhibits the reaction [TGFB1 protein results in increased phosphorylation of PTK2 protein]] and ophiopogonin D inhibits the reaction [TGFB1 protein results in increased phosphorylation of PTK2 protein] CTD PMID:32818624 Ptk2 Rat oxotremorine M multiple interactions ISO PTK2 (Homo sapiens) 6480464 [oxophenylarsine co-treated with oxotremorine M] results in increased phosphorylation of PTK2 protein more ... CTD PMID:10537051 Ptk2 Rat oxotremorine M increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 oxotremorine M results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat ozone decreases expression EXP 6480464 Ozone results in decreased expression of PTK2 mRNA CTD PMID:16330353 Ptk2 Rat p-menthan-3-ol decreases expression ISO PTK2 (Homo sapiens) 6480464 Menthol results in decreased expression of PTK2 mRNA CTD PMID:26760959 Ptk2 Rat p-tert-Amylphenol increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 4-tert-octylphenol results in increased phosphorylation of PTK2 protein CTD PMID:32466334 Ptk2 Rat paracetamol decreases expression ISO PTK2 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of PTK2 mRNA CTD PMID:22230336 Ptk2 Rat pentachlorophenol increases expression ISO Ptk2 (Mus musculus) 6480464 Pentachlorophenol results in increased expression of PTK2 mRNA CTD PMID:23892564 Ptk2 Rat perfluorohexanesulfonic acid decreases expression ISO Ptk2 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in decreased expression of PTK2 mRNA CTD PMID:37995155 Ptk2 Rat perfluorooctane-1-sulfonic acid decreases expression EXP 6480464 perfluorooctane sulfonic acid results in decreased expression of PTK2 mRNA CTD PMID:20136073 Ptk2 Rat perfluorooctane-1-sulfonic acid decreases response to substance ISO PTK2 (Homo sapiens) 6480464 PTK2 protein mutant form results in decreased susceptibility to perfluorooctane sulfonic acid CTD PMID:29150642 Ptk2 Rat perfluorooctane-1-sulfonic acid increases expression ISO Ptk2 (Mus musculus) 6480464 perfluorooctane sulfonic acid results in increased expression of PTK2 protein CTD PMID:26178269 Ptk2 Rat phenethyl caffeate decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 caffeic acid phenethyl ester results in decreased phosphorylation of PTK2 protein CTD PMID:10741720 Ptk2 Rat phenylarsine oxide multiple interactions ISO PTK2 (Homo sapiens) 6480464 [oxophenylarsine co-treated with oxotremorine M] results in increased phosphorylation of PTK2 protein more ... CTD PMID:10537051 and PMID:10569804 Ptk2 Rat phenylarsine oxide increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 oxophenylarsine results in increased phosphorylation of PTK2 protein CTD PMID:10537051 Ptk2 Rat phenylmercury acetate decreases expression ISO PTK2 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of PTK2 mRNA CTD PMID:26272509 Ptk2 Rat phenylmercury acetate multiple interactions ISO PTK2 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of PTK2 mRNA CTD PMID:27188386 Ptk2 Rat phorbol 13-acetate 12-myristate multiple interactions ISO PTK2 (Homo sapiens) 6480464 [oxophenylarsine co-treated with Tetradecanoylphorbol Acetate] results in decreased expression of PTK2 protein more ... CTD PMID:10537051 more ... Ptk2 Rat phorbol 13-acetate 12-myristate increases expression ISO PTK2 (Homo sapiens) 6480464 Tetradecanoylphorbol Acetate results in increased expression of PTK2 protein CTD PMID:37562720 Ptk2 Rat phorbol 13-acetate 12-myristate increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Tetradecanoylphorbol Acetate results in increased phosphorylation of PTK2 protein CTD PMID:10537051 more ... Ptk2 Rat phosgene affects expression ISO Ptk2 (Mus musculus) 6480464 Phosgene affects the expression of PTK2 mRNA CTD PMID:16300373 Ptk2 Rat picoxystrobin increases expression ISO PTK2 (Homo sapiens) 6480464 picoxystrobin results in increased expression of PTK2 mRNA CTD PMID:33512557 Ptk2 Rat pinosylvin decreases expression ISO PTK2 (Homo sapiens) 6480464 pinosylvin results in decreased expression of PTK2 protein modified form CTD PMID:23333577 Ptk2 Rat pirinixic acid increases expression ISO Ptk2 (Mus musculus) 6480464 pirinixic acid results in increased expression of PTK2 mRNA CTD PMID:18301758 Ptk2 Rat platycodin D decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 platycodin D results in decreased phosphorylation of PTK2 protein CTD PMID:25250884 Ptk2 Rat poly(vinylpyrrolidone) multiple interactions ISO Ptk2 (Mus musculus) 6480464 [Silver Compounds co-treated with Povidone] results in increased activity of PTK2 protein CTD PMID:21729742 Ptk2 Rat potassium chromate multiple interactions ISO PTK2 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of PTK2 mRNA CTD PMID:22079256 Ptk2 Rat potassium chromate decreases expression ISO PTK2 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of PTK2 mRNA CTD PMID:22079256 Ptk2 Rat potassium iodide decreases expression EXP 6480464 Potassium Iodide results in decreased expression of PTK2 protein and Potassium Iodide results in decreased expression of PTK2 protein modified form CTD PMID:32593569 Ptk2 Rat progesterone decreases expression EXP 6480464 Progesterone results in decreased expression of PTK2 mRNA CTD PMID:20726854 Ptk2 Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of PTK2 protein CTD PMID:20959644 Ptk2 Rat progesterone multiple interactions EXP 6480464 Mifepristone inhibits the reaction [Progesterone results in increased expression of PTK2 protein] CTD PMID:20959644 Ptk2 Rat protein kinase inhibitor multiple interactions ISO Ptk2 (Mus musculus) 6480464 [Protein Kinase Inhibitors results in decreased activity of PTK2 protein] inhibits the reaction [IL1B protein results in increased expression of MMP1 mRNA] CTD PMID:30098273 Ptk2 Rat protein kinase inhibitor decreases activity ISO Ptk2 (Mus musculus) 6480464 Protein Kinase Inhibitors results in decreased activity of PTK2 protein CTD PMID:30098273 Ptk2 Rat quercetin multiple interactions ISO PTK2 (Homo sapiens) 6480464 EGF protein inhibits the reaction [Quercetin results in decreased phosphorylation of PTK2 protein] more ... CTD PMID:15135307 and PMID:25971889 Ptk2 Rat quercetin decreases expression ISO PTK2 (Homo sapiens) 6480464 Quercetin results in decreased expression of PTK2 protein CTD PMID:23645742 Ptk2 Rat quercetin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Quercetin results in decreased phosphorylation of PTK2 protein CTD PMID:15135307 and PMID:25971889 Ptk2 Rat quercetin 3-O-beta-D-glucofuranoside multiple interactions ISO PTK2 (Homo sapiens) 6480464 isoquercitrin inhibits the reaction [EGF protein results in increased phosphorylation of PTK2 protein] CTD PMID:26109002 Ptk2 Rat quercetin 3-O-beta-D-glucopyranoside multiple interactions ISO PTK2 (Homo sapiens) 6480464 isoquercitrin inhibits the reaction [EGF protein results in increased phosphorylation of PTK2 protein] CTD PMID:26109002 Ptk2 Rat quinacrine decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Quinacrine results in decreased phosphorylation of PTK2 protein CTD PMID:35724837 Ptk2 Rat reactive oxygen species multiple interactions ISO PTK2 (Homo sapiens) 6480464 [[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein more ... CTD PMID:11213483 and PMID:17888894 Ptk2 Rat reactive oxygen species increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Reactive Oxygen Species results in increased phosphorylation of PTK2 protein CTD PMID:11213483 Ptk2 Rat resveratrol increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 resveratrol results in increased phosphorylation of PTK2 protein CTD PMID:12421874 Ptk2 Rat resveratrol decreases expression ISO Ptk2 (Mus musculus) 6480464 resveratrol results in decreased expression of PTK2 protein modified form CTD PMID:24659233 Ptk2 Rat resveratrol decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 resveratrol results in decreased phosphorylation of PTK2 protein CTD PMID:12421874 and PMID:25605016 Ptk2 Rat resveratrol affects localization ISO PTK2 (Homo sapiens) 6480464 resveratrol affects the localization of PTK2 protein CTD PMID:21467134 Ptk2 Rat resveratrol multiple interactions ISO PTK2 (Homo sapiens) 6480464 resveratrol promotes the reaction [[ITGAV protein binds to ITGB3 protein] which affects the localization of PTK2 protein] CTD PMID:21467134 Ptk2 Rat resveratrol decreases expression ISO PTK2 (Homo sapiens) 6480464 resveratrol results in decreased expression of PTK2 mRNA and resveratrol results in decreased expression of PTK2 protein CTD PMID:18089832 Ptk2 Rat rotenone increases expression ISO PTK2 (Homo sapiens) 6480464 Rotenone results in increased expression of PTK2 mRNA CTD PMID:33512557 Ptk2 Rat S-butyl-DL-homocysteine (S,R)-sulfoximine increases expression ISO Ptk2 (Mus musculus) 6480464 Buthionine Sulfoximine results in increased expression of PTK2 mRNA CTD PMID:15878706 Ptk2 Rat Salinomycin decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 salinomycin results in decreased phosphorylation of PTK2 protein CTD PMID:28395993 Ptk2 Rat Salvianolic acid A decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 salvianolic acid A results in decreased phosphorylation of PTK2 protein CTD PMID:29385302 Ptk2 Rat SB 431542 multiple interactions ISO PTK2 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Ptk2 Rat silver atom increases phosphorylation EXP 6480464 Silver results in increased phosphorylation of PTK2 protein CTD PMID:11341783 Ptk2 Rat silver(0) increases phosphorylation EXP 6480464 Silver results in increased phosphorylation of PTK2 protein CTD PMID:11341783 Ptk2 Rat simvastatin decreases activity ISO PTK2 (Homo sapiens) 6480464 Simvastatin results in decreased activity of PTK2 protein CTD PMID:17428261 Ptk2 Rat sirolimus decreases phosphorylation ISO Ptk2 (Mus musculus) 6480464 Sirolimus results in decreased phosphorylation of PTK2 protein CTD PMID:19922502 Ptk2 Rat sodium arsenite increases expression ISO PTK2 (Homo sapiens) 6480464 sodium arsenite results in increased expression of PTK2 mRNA CTD PMID:12016162 Ptk2 Rat sodium arsenite decreases phosphorylation EXP 6480464 sodium arsenite results in decreased phosphorylation of PTK2 protein CTD PMID:15537746 Ptk2 Rat sodium chloride increases expression ISO PTK2 (Homo sapiens) 6480464 Sodium Chloride results in increased expression of PTK2 mRNA CTD PMID:23634900 Ptk2 Rat sodium chloride multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of PTK2 protein more ... CTD PMID:38598786 Ptk2 Rat sulindac sulfide decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 sulindac sulfide results in decreased phosphorylation of PTK2 protein CTD PMID:10741720 Ptk2 Rat tamoxifen affects expression ISO Ptk2 (Mus musculus) 6480464 Tamoxifen affects the expression of PTK2 mRNA CTD PMID:17555576 Ptk2 Rat terbinafine decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 terbinafine results in decreased phosphorylation of PTK2 protein CTD PMID:17172416 Ptk2 Rat tert-butyl hydroperoxide decreases expression ISO PTK2 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased expression of PTK2 mRNA CTD PMID:15336504 Ptk2 Rat testosterone increases phosphorylation ISO PTK2 (Homo sapiens) 6480464 Testosterone results in increased phosphorylation of PTK2 protein CTD PMID:16038899 Ptk2 Rat testosterone multiple interactions ISO PTK2 (Homo sapiens) 6480464 wortmannin inhibits the reaction [Testosterone results in increased phosphorylation of PTK2 protein] CTD PMID:16038899 Ptk2 Rat tetrachloromethane increases expression ISO Ptk2 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of PTK2 mRNA CTD PMID:31919559 Ptk2 Rat tetrathiomolybdate(2-) multiple interactions EXP 6480464 [Copper deficiency co-treated with tetrathiomolybdate] results in decreased phosphorylation of PTK2 protein CTD PMID:22276220 Ptk2 Rat thapsigargin decreases expression ISO Ptk2 (Mus musculus) 6480464 Thapsigargin results in decreased expression of PTK2 protein CTD PMID:24648495 Ptk2 Rat thimerosal increases response to substance ISO PTK2 (Homo sapiens) 6480464 PTK2 protein results in increased susceptibility to Thimerosal CTD PMID:17888894 Ptk2 Rat thimerosal multiple interactions ISO PTK2 (Homo sapiens) 6480464 [[Thimerosal results in increased abundance of Reactive Oxygen Species] which results in increased activity of CASP3 protein] which results in increased cleavage of PTK2 protein more ... CTD PMID:17888894 Ptk2 Rat thiopental multiple interactions EXP 6480464 bisindolylmaleimide I inhibits the reaction [Thiopental results in increased phosphorylation of PTK2 protein] more ... CTD PMID:15194624 Ptk2 Rat thiopental increases phosphorylation EXP 6480464 Thiopental results in increased phosphorylation of PTK2 protein CTD PMID:15194624 Ptk2 Rat titanium dioxide decreases methylation ISO Ptk2 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of PTK2 gene CTD PMID:35295148 Ptk2 Rat titanium dioxide increases methylation ISO Ptk2 (Mus musculus) 6480464 titanium dioxide results in increased methylation of PTK2 promoter CTD PMID:35295148 Ptk2 Rat trans-pinosylvin decreases expression ISO PTK2 (Homo sapiens) 6480464 pinosylvin results in decreased expression of PTK2 protein modified form CTD PMID:23333577 Ptk2 Rat trichostatin A decreases expression ISO PTK2 (Homo sapiens) 6480464 trichostatin A results in decreased expression of PTK2 mRNA CTD PMID:24935251 Ptk2 Rat triphenyl phosphate affects expression ISO PTK2 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of PTK2 mRNA CTD PMID:37042841 Ptk2 Rat Triptolide decreases expression ISO Ptk2 (Mus musculus) 6480464 triptolide results in decreased expression of PTK2 mRNA and triptolide results in decreased expression of PTK2 protein CTD PMID:26420756 Ptk2 Rat Triptolide increases expression EXP 6480464 triptolide results in increased expression of PTK2 protein CTD PMID:32519852 Ptk2 Rat Triptolide increases expression ISO Ptk2 (Mus musculus) 6480464 triptolide results in increased expression of PTK2 protein CTD PMID:26990902 Ptk2 Rat tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate multiple interactions ISO PTK2 (Homo sapiens) 6480464 Atropine inhibits the reaction [oxotremorine M inhibits the reaction [[Wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein]] more ... CTD PMID:10537051 Ptk2 Rat Tryptanthrine decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 tryptanthrine results in decreased phosphorylation of PTK2 protein CTD PMID:26341616 Ptk2 Rat tyrphostin AG 1478 multiple interactions ISO PTK2 (Homo sapiens) 6480464 [RTKI cpd co-treated with bisphenol A] results in increased phosphorylation of PTK2 protein CTD PMID:32325111 Ptk2 Rat uranium atom affects expression ISO PTK2 (Homo sapiens) 6480464 Uranium affects the expression of PTK2 mRNA CTD PMID:15672453 Ptk2 Rat valproic acid affects expression ISO PTK2 (Homo sapiens) 6480464 Valproic Acid affects the expression of PTK2 mRNA CTD PMID:25979313 Ptk2 Rat valproic acid multiple interactions ISO PTK2 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of PTK2 mRNA CTD PMID:27188386 Ptk2 Rat valproic acid decreases expression ISO PTK2 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of PTK2 mRNA CTD PMID:23179753 more ... Ptk2 Rat wortmannin multiple interactions ISO PTK2 (Homo sapiens) 6480464 [Pilocarpine co-treated with wortmannin] results in increased phosphorylation of PTK2 protein more ... CTD PMID:10537051 and PMID:16038899 Ptk2 Rat wortmannin multiple interactions EXP 6480464 [wortmannin co-treated with lysophosphatidic acid] results in increased phosphorylation of PTK2 protein more ... CTD PMID:10537051 Ptk2 Rat zearalenone decreases expression ISO Ptk2 (Mus musculus) 6480464 Zearalenone results in decreased expression of PTK2 protein CTD PMID:36288102 Ptk2 Rat zearalenone decreases expression EXP 6480464 Zearalenone results in decreased expression of PTK2 protein CTD PMID:36288102 Ptk2 Rat zoledronic acid decreases phosphorylation ISO PTK2 (Homo sapiens) 6480464 zoledronic acid results in decreased phosphorylation of PTK2 protein CTD PMID:12933798 Ptk2 Rat zoledronic acid increases expression ISO PTK2 (Homo sapiens) 6480464 zoledronic acid results in increased expression of PTK2 mRNA CTD PMID:20977926
Imported Annotations - KEGG (archival)
(+)-catechin (ISO) (+)-pilocarpine (ISO) (-)-epigallocatechin 3-gallate (ISO) (S)-nicotine (ISO) 1,2-dimethylhydrazine (ISO) 1,4-dithiothreitol (ISO) 1,8-cineole (ISO) 1-octadec-9-enoylglycero-3-phosphate (EXP,ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 2,6-dimethoxyphenol (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (EXP) 3,4-methylenedioxymethamphetamine (ISO) 3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione (EXP) 3-methylcholanthrene (ISO) 3H-1,2-dithiole-3-thione (EXP) 4,4'-sulfonyldiphenol (ISO) 4-(N-nitrosomethylamino)-1-(3-pyridyl)butan-1-one (ISO) 4-hydroxycoumarin (ISO) 4-hydroxynon-2-enal (ISO) 4-tert-Octylphenol (ISO) 5-fluorouracil (ISO) 8-Br-cAMP (ISO) acrylamide (ISO) actinomycin D (EXP) aflatoxin B1 (ISO) aldehydo-D-glucose (EXP,ISO) all-trans-retinoic acid (ISO) alpha-naphthoflavone (ISO) aluminium oxide (ISO) AM-251 (ISO) ammonium chloride (EXP,ISO) amosite asbestos (ISO) Anetholtrithion (ISO) antirheumatic drug (ISO) aristolochic acid A (ISO) arsane (EXP,ISO) arsenic atom (EXP,ISO) arsenite(3-) (ISO) atrazine (EXP,ISO) atropine (ISO) barium(0) (ISO) benzene (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-lapachone (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) blebbistatin (ISO) BQ 123 (ISO) bufalin (ISO) Butylbenzyl phthalate (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) calyculin a (ISO) cannabidiol (ISO) capsaicin (ISO) carbamazepine (ISO) carbon nanotube (ISO) carvone (ISO) casticin (ISO) CGP 52608 (ISO) chelerythrine (EXP) chlorpyrifos (EXP) chromium(6+) (ISO) chrysin (ISO) cisplatin (EXP,ISO) clozapine (ISO) cocaine (ISO) copper atom (EXP,ISO) copper(0) (EXP,ISO) cordycepin (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) D-glucose (EXP,ISO) D-mannitol (ISO) daidzein (ISO) deguelin (ISO) Di-n-octyl phthalate (ISO) diallyl trisulfide (ISO) dibenzo[a,l]pyrene (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) diclofenac (ISO) Dictamnine (ISO) diethyl phthalate (ISO) Diisodecyl phthalate (ISO) diisononyl phthalate (ISO) dioscin (ISO) dioxygen (EXP) disodium selenite (ISO) dorsomorphin (ISO) doxazosin (ISO) doxorubicin (EXP,ISO) emodin (EXP) endosulfan (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) everolimus (ISO) fenthion (ISO) flavonoids (EXP) flavonol (ISO) flubendazole (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) fulvestrant (ISO) furfural (ISO) gadolinium trichloride (ISO) gallic acid (ISO) Garcinol (ISO) geldanamycin (ISO) gemcitabine (ISO) genistein (ISO) Geraniin (ISO) glucose (EXP,ISO) halothane (ISO) heparin (ISO) hyaluronic acid (EXP) hydrogen peroxide (EXP,ISO) indometacin (ISO) irinotecan (ISO) isoflurane (EXP) ivermectin (ISO) ketamine (EXP) L-1,4-dithiothreitol (ISO) L-ascorbic acid (EXP) lead(0) (EXP,ISO) lipopolysaccharide (ISO) lithocholic acid (ISO) luteolin (ISO) LY294002 (ISO) magnesium atom (ISO) mebendazole (ISO) methidathion (ISO) methyl methanesulfonate (ISO) methylisothiazolinone (EXP) methylmercury chloride (ISO) microcystin-LR (EXP) mifepristone (EXP) MitoTEMPO (ISO) ML-7 (ISO) morphine (EXP) N(4)-hydroxycytidine (ISO) N-acetyl-L-cysteine (ISO) nickel dichloride (ISO) nicotine (ISO) nitric oxide (ISO) ochratoxin A (ISO) Octicizer (ISO) okadaic acid (ISO) Ophiopogonin D (ISO) oxotremorine M (ISO) ozone (EXP) p-menthan-3-ol (ISO) p-tert-Amylphenol (ISO) paracetamol (ISO) pentachlorophenol (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (EXP,ISO) phenethyl caffeate (ISO) phenylarsine oxide (ISO) phenylmercury acetate (ISO) phorbol 13-acetate 12-myristate (ISO) phosgene (ISO) picoxystrobin (ISO) pinosylvin (ISO) pirinixic acid (ISO) platycodin D (ISO) poly(vinylpyrrolidone) (ISO) potassium chromate (ISO) potassium iodide (EXP) progesterone (EXP) protein kinase inhibitor (ISO) quercetin (ISO) quercetin 3-O-beta-D-glucofuranoside (ISO) quercetin 3-O-beta-D-glucopyranoside (ISO) quinacrine (ISO) reactive oxygen species (ISO) resveratrol (ISO) rotenone (ISO) S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO) Salinomycin (ISO) Salvianolic acid A (ISO) SB 431542 (ISO) silver atom (EXP) silver(0) (EXP) simvastatin (ISO) sirolimus (ISO) sodium arsenite (EXP,ISO) sodium chloride (ISO) sulindac sulfide (ISO) tamoxifen (ISO) terbinafine (ISO) tert-butyl hydroperoxide (ISO) testosterone (ISO) tetrachloromethane (ISO) tetrathiomolybdate(2-) (EXP) thapsigargin (ISO) thimerosal (ISO) thiopental (EXP) titanium dioxide (ISO) trans-pinosylvin (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) Triptolide (EXP,ISO) tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate (ISO) Tryptanthrine (ISO) tyrphostin AG 1478 (ISO) uranium atom (ISO) valproic acid (ISO) wortmannin (EXP,ISO) zearalenone (EXP,ISO) zoledronic acid (ISO)
Biological Process
angiogenesis (IEA,ISO) axonogenesis (ISO) blood vessel development (ISO) cell migration (ISO) cellular response to morphine (IEP) cellular response to transforming growth factor beta stimulus (ISO) central nervous system neuron axonogenesis (ISO) endothelial cell migration (ISO) ephrin receptor signaling pathway (ISO,ISS) epidermal growth factor receptor signaling pathway (IBA) extracellular matrix organization (ISO) fat cell differentiation (IEP) growth hormone receptor signaling pathway (ISO) integrin-mediated signaling pathway (ISO,ISS) intracellular chloride ion homeostasis (IMP) JNK cascade (IMP) MAPK cascade (IMP) microtubule cytoskeleton organization (ISO) negative regulation of anoikis (ISO) negative regulation of apoptotic process (IMP,ISO) negative regulation of autophagy (ISO) negative regulation of axonogenesis (ISO) negative regulation of cell migration (IMP) negative regulation of cell-cell adhesion (ISO) negative regulation of organ growth (ISO) negative regulation of synapse assembly (ISO) neuron migration (ISO) nuclear migration (ISO) organ growth (ISO) peptidyl-tyrosine autophosphorylation (ISO) peptidyl-tyrosine phosphorylation (ISO,ISS) positive regulation of cardiac muscle hypertrophy (ISO) positive regulation of cell adhesion (IMP) positive regulation of cell growth (IMP) positive regulation of cell migration (IBA,IMP,ISO) positive regulation of cell population proliferation (IEA,ISO,ISS) positive regulation of epithelial cell migration (ISO) positive regulation of epithelial to mesenchymal transition (ISO) positive regulation of fibroblast migration (ISO) positive regulation of glial cell proliferation (IMP) positive regulation of macrophage chemotaxis (ISO) positive regulation of macrophage proliferation (ISO) positive regulation of phagocytosis (IMP) positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (ISO,ISS) positive regulation of protein kinase activity (ISO,ISS) positive regulation of protein phosphorylation (ISO,ISS) positive regulation of smooth muscle cell migration (IMP) positive regulation of smooth muscle cell proliferation (IMP) positive regulation of synaptic transmission (IMP) positive regulation of ubiquitin-dependent protein catabolic process (ISO,ISS) positive regulation of wound healing (ISO) protein autophosphorylation (ISO,ISS) regulation of biological quality (IEA) regulation of cell adhesion (IBA) regulation of cell adhesion mediated by integrin (ISO,ISS) regulation of cell population proliferation (ISO,ISS) regulation of cell shape (ISO,ISS) regulation of cellular component organization (IEA) regulation of epithelial cell migration (ISO) regulation of focal adhesion assembly (ISO) regulation of modification of postsynaptic actin cytoskeleton (ISO) regulation of multicellular organismal process (IEA) regulation of osteoblast differentiation (ISO,ISS) regulation of protein phosphorylation (ISO) regulation of substrate adhesion-dependent cell spreading (ISO) response to arsenic-containing substance (IEP) response to estradiol (IEP) response to glucose (IEP) response to mechanical stimulus (IEP) response to xenobiotic stimulus (IEP) signal complex assembly (IEA) transforming growth factor beta receptor signaling pathway (ISO) vasculogenesis (ISO) vasodilation (IMP)
Cellular Component
anchoring junction (IEA) apical plasma membrane (IDA,ISO) basolateral plasma membrane (IDA) cell cortex (IEA) cell projection (IEA) centrosome (IEA) ciliary basal body (ISO,ISS) cilium (ISO) cytoplasm (IEA) cytoskeleton (IEA) cytosol (ISO,ISS) focal adhesion (IBA,IDA,IEA,ISO,TAS) glutamatergic synapse (IDA,IEA,ISO) intercalated disc (IDA) intracellular membrane-bounded organelle (ISO) lamellipodium (ISO) membrane (IEA) nuclear body (IDA) nucleus (IEA,ISO) perinuclear region of cytoplasm (IEA) plasma membrane (IBA,IEA) postsynapse (IDA) sarcolemma (IDA) stress fiber (ISO)
1.
Extracellular signal-regulated kinase activation during renal ischemia/reperfusion mediates focal adhesion dissolution and renal injury.
Alderliesten M, etal., Am J Pathol. 2007 Aug;171(2):452-62. Epub 2007 Jul 9.
2.
A role for enhanced integrin and FAK expression in uremia-induced parathyroid hyperplasia.
Arcidiacono MV, etal., J Nephrol. 2007 Mar-Apr;20(2):228-33.
3.
Integrin dynamics produce a delayed stage of long-term potentiation and memory consolidation.
Babayan AH, etal., J Neurosci. 2012 Sep 12;32(37):12854-61. doi: 10.1523/JNEUROSCI.2024-12.2012.
4.
Focal adhesion kinase protein levels in gut epithelial motility.
Basson MD, etal., Am J Physiol Gastrointest Liver Physiol. 2006 Sep;291(3):G491-9.
5.
Focal adhesion kinase (FAK)-dependent regulation of S-phase kinase-associated protein-2 (Skp-2) stability. A novel mechanism regulating smooth muscle cell proliferation.
Bond M, etal., J Biol Chem. 2004 Sep 3;279(36):37304-10. Epub 2004 Jun 18.
6.
FAK dimerization controls its kinase-dependent functions at focal adhesions.
Brami-Cherrier K, etal., EMBO J. 2014 Feb 18;33(4):356-70. doi: 10.1002/embj.201386399. Epub 2014 Jan 30.
7.
Cloning of focal adhesion kinase, pp125FAK, from rat brain reveals multiple transcripts with different patterns of expression.
Burgaya F and Girault JA, Brain Res Mol Brain Res 1996 Apr;37(1-2):63-73.
8.
The effects of morphine treatment on the NCAM and its signaling in the MLDS of rats.
Cao JP, etal., Drug Chem Toxicol. 2016 Oct;39(4):418-23. doi: 10.3109/01480545.2015.1137302. Epub 2016 Jan 28.
9.
Integrin beta1 is involved in the signaling of glial cell line-derived neurotrophic factor.
Cao JP, etal., J Comp Neurol. 2008 Jul 10;509(2):203-10.
10.
Dystrophin Dp71f associates with the beta1-integrin adhesion complex to modulate PC12 cell adhesion.
Cerna J, etal., J Mol Biol. 2006 Oct 6;362(5):954-65. Epub 2006 Aug 1.
11.
Gonadotropin releasing hormone analogue therapy alters signal transduction pathways involving mitogen-activated protein and focal adhesion kinases in leiomyoma.
Chegini N and Kornberg L, J Soc Gynecol Investig. 2003 Jan;10(1):21-6.
12.
[Effects of prednisone on renal FAK and Pyk2 expressions in rats with adriamycin- induced nephritis].
Chen X, etal., Nan Fang Yi Ke Da Xue Xue Bao. 2014 Jul;34(8):1149-53.
13.
Effects of dexmedetomidine on hippocampal focal adhesion kinase tyrosine phosphorylation in physiologic and ischemic conditions.
Dahmani S, etal., Anesthesiology. 2005 Nov;103(5):969-77.
14.
Thiopental and isoflurane attenuate the decrease in hippocampal phosphorylated Focal Adhesion Kinase (pp125FAK) content induced by oxygen-glucose deprivation.
Dahmani S, etal., Br J Anaesth. 2004 Aug;93(2):270-4. Epub 2004 Jun 11.
15.
Lidocaine increases phosphorylation of focal adhesion kinase in rat hippocampal slices.
Dahmani S, etal., Eur J Pharmacol. 2004 Apr 5;489(1-2):55-8.
16.
Focal adhesion kinase as a RhoA-activable signaling scaffold mediating Akt activation and cardiomyocyte protection.
Del Re DP, etal., J Biol Chem. 2008 Dec 19;283(51):35622-9. Epub 2008 Oct 14.
17.
Regulation of a neuronal form of focal adhesion kinase by anandamide.
Derkinderen P, etal., Science 1996 Sep 20;273(5282):1719-22.
18.
Focal adhesion kinase signaling promotes phagocytosis of integrin-bound photoreceptors.
Finnemann SC EMBO J 2003 Aug 15;22(16):4143-54.
19.
Fibre-type specific concentration of focal adhesion kinase at the sarcolemma: influence of fibre innervation and regeneration.
Fluck M, etal., J Exp Biol. 2002 Aug;205(Pt 16):2337-48.
20.
Weak expression of focal adhesion kinase (pp125FAK) in patients with cervical cancer is associated with poor disease outcome.
Gabriel B, etal., Clin Cancer Res. 2006 Apr 15;12(8):2476-83.
21.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
22.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
23.
Bit-1 mediates integrin-dependent cell survival through activation of the NFkappaB pathway.
Griffiths GS, etal., J Biol Chem. 2011 Apr 22;286(16):14713-23. doi: 10.1074/jbc.M111.228387. Epub 2011 Mar 7.
24.
Differential expression of protease activated receptor 1 (Par1) and pY397FAK in benign and malignant human ovarian tissue samples.
Grisaru-Granovsky S, etal., Int J Cancer. 2005 Jan 20;113(3):372-8.
25.
The role of PTPN13 in invasion and metastasis of lung squamous cell carcinoma.
Han X, etal., Exp Mol Pathol. 2013 Dec;95(3):270-5. doi: 10.1016/j.yexmp.2013.07.008. Epub 2013 Jul 29.
26.
Regional Regulation of Purkinje Cell Dendritic Spines by Integrins and Eph/Ephrins.
Heintz TG, etal., PLoS One. 2016 Aug 12;11(8):e0158558. doi: 10.1371/journal.pone.0158558. eCollection 2016.
27.
Vascular endothelial growth factor receptor-2: structure, function, intracellular signalling and therapeutic inhibition.
Holmes K, etal., Cell Signal. 2007 Oct;19(10):2003-12. Epub 2007 Jun 12.
28.
Relationship between focal adhesion kinase and hepatic stellate cell proliferation during rat hepatic fibrogenesis.
Jiang HQ, etal., World J Gastroenterol. 2004 Oct 15;10(20):3001-5.
29.
Overexpression of focal adhesion kinase, a protein tyrosine kinase, in ovarian carcinoma.
Judson PL, etal., Cancer. 1999 Oct 15;86(8):1551-6.
30.
The GIT family of proteins forms multimers and associates with the presynaptic cytomatrix protein Piccolo.
Kim S, etal., J Biol Chem. 2003 Feb 21;278(8):6291-300. Epub 2002 Dec 6.
31.
Interaction between liprin-alpha and GIT1 is required for AMPA receptor targeting.
Ko J, etal., J Neurosci. 2003 Mar 1;23(5):1667-77.
32.
Role of focal adhesion kinase in flow-induced dilation of coronary arterioles.
Koshida R, etal., Arterioscler Thromb Vasc Biol. 2005 Dec;25(12):2548-53. Epub 2005 Sep 29.
33.
Focal adhesion kinase is required for endothelin-induced cell cycle progression of cultured astrocytes.
Koyama Y, etal., Glia. 2003 Aug;43(2):185-9.
34.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
35.
Mammary epithelial-specific disruption of the focal adhesion kinase blocks mammary tumor progression.
Lahlou H, etal., Proc Natl Acad Sci U S A. 2007 Dec 18;104(51):20302-7. Epub 2007 Dec 3.
36.
The effect of elevated extracellular glucose on adherens junction proteins in cultured rat heart endothelial cells.
Lee HZ, etal., Life Sci. 2004 Mar 12;74(17):2085-96.
37.
Cleavage of focal adhesion kinase (FAK) is essential in adipocyte differentiation.
Li JJ and Xie D, Biochem Biophys Res Commun. 2007 Jun 8;357(3):648-54. Epub 2007 Apr 9.
38.
NCAM signaling mediates the effects of GDNF on chronic morphine-induced neuroadaptations.
Li L, etal., J Mol Neurosci. 2014 Aug;53(4):580-9. doi: 10.1007/s12031-013-0224-0. Epub 2014 Jan 8.
39.
Zhonghua bing li xue za zhi Chinese journal of pathology
Li ZY, etal., Zhonghua Bing Li Xue Za Zhi. 2007 Oct;36(10):677-80.
40.
Upregulation of focal adhesion kinase (FAK) expression in ductal carcinoma in situ (DCIS) is an early event in breast tumorigenesis.
Lightfoot HM Jr, etal., Breast Cancer Res Treat. 2004 Nov;88(2):109-16.
41.
Expression of integrinalpha5beta1, focal adhesion kinase and integrin-linked kinase in rat condylar cartilage during mandibular lateral displacement.
Liu C, etal., Arch Oral Biol. 2008 Mar 20;.
42.
Focal adhesion kinase overexpression in endometrial neoplasia.
Livasy CA, etal., Appl Immunohistochem Mol Morphol. 2004 Dec;12(4):342-5.
43.
Increased tyrosine phosphorylation of platelet proteins including pp125(FAK) suggests endogenous activation and aggregation in pulmonary hypertension.
Maeda NY, etal., Clin Appl Thromb Hemost. 2005 Oct;11(4):411-5.
44.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
45.
Intrinsic focal adhesion kinase activity controls orthotopic breast carcinoma metastasis via the regulation of urokinase plasminogen activator expression in a syngeneic tumor model.
Mitra SK, etal., Oncogene. 2006 Jul 27;25(32):4429-40. Epub 2006 Mar 20.
46.
The expression and tyrosine phosphorylation of E-cadherin/catenin adhesion complex, and focal adhesion kinase in invasive cervical carcinomas.
Moon HS, etal., Int J Gynecol Cancer. 2003 Sep-Oct;13(5):640-6.
47.
Alteration of focal adhesion kinase expression in eutopic endometrium of women with endometriosis.
Mu L, etal., Fertil Steril. 2008 Mar;89(3):529-37. Epub 2007 Jun 4.
48.
High resolution genomic analysis of sporadic breast cancer using array-based comparative genomic hybridization.
Naylor TL, etal., Breast Cancer Res. 2005;7(6):R1186-98. Epub 2005 Nov 24.
49.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
50.
Marked suppression of tumor growth by FTY720 in a rat liver tumor model: the significance of down-regulation of cell survival Akt pathway.
Ng KT, etal., Int J Oncol. 2007 Feb;30(2):375-80.
51.
Expression of focal adhesion kinase in small-cell lung carcinoma.
Ocak S, etal., Cancer. 2012 Mar 1;118(5):1293-301. doi: 10.1002/cncr.26382. Epub 2011 Jul 28.
52.
DNA copy number aberrations in small-cell lung cancer reveal activation of the focal adhesion pathway.
Ocak S, etal., Oncogene. 2010 Dec 2;29(48):6331-42. doi: 10.1038/onc.2010.362. Epub 2010 Aug 30.
53.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
54.
FAK-related nonkinase attenuates hypertrophy induced by angiotensin-II in cultured neonatal rat cardiac myocytes.
Qin J and Liu ZX, Acta Pharmacol Sin. 2006 Sep;27(9):1159-64.
55.
Role of protein-tyrosine phosphatase SHP2 in focal adhesion kinase down-regulation during neutrophil cathepsin G-induced cardiomyocytes anoikis.
Rafiq K, etal., J Biol Chem. 2006 Jul 14;281(28):19781-92. Epub 2006 May 11.
56.
c-Cbl ubiquitin ligase regulates focal adhesion protein turnover and myofibril degeneration induced by neutrophil protease cathepsin G.
Rafiq K, etal., J Biol Chem. 2012 Feb 17;287(8):5327-39. doi: 10.1074/jbc.M111.307009. Epub 2011 Dec 27.
57.
Thy-1, via its GPI anchor, modulates Src family kinase and focal adhesion kinase phosphorylation and subcellular localization, and fibroblast migration, in response to thrombospondin-1/hep I.
Rege TA, etal., Exp Cell Res. 2006 Nov 15;312(19):3752-67. Epub 2006 Sep 12.
58.
GOA pipeline
RGD automated data pipeline
59.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
60.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
61.
Expression of focal adhesion kinase in normal and pathologic human prostate tissues.
Rovin JD, etal., Prostate. 2002 Oct 1;53(2):124-32.
62.
Multiple connections link FAK to cell motility and invasion.
Schlaepfer DD and Mitra SK, Curr Opin Genet Dev. 2004 Feb;14(1):92-101.
63.
Beta1-adrenergic receptors promote focal adhesion signaling downregulation and myocyte apoptosis in acute volume overload.
Seqqat R, etal., J Mol Cell Cardiol. 2012 Aug;53(2):240-9. doi: 10.1016/j.yjmcc.2012.05.004. Epub 2012 May 15.
64.
Focal adhesion kinase is a blood-testis barrier regulator.
Siu ER, etal., Proc Natl Acad Sci U S A. 2009 Jun 9;106(23):9298-303. doi: 10.1073/pnas.0813113106. Epub 2009 May 21.
65.
Focal adhesion kinase and paxillin: novel regulators of brain sexual differentiation?
Speert DB, etal., Endocrinology. 2007 Jul;148(7):3391-401. Epub 2007 Apr 5.
66.
Variations of proline-rich kinase Pyk2 expression correlate with prostate cancer progression.
Stanzione R, etal., Lab Invest. 2001 Jan;81(1):51-9.
67.
P-glycoprotein regulates blood-testis barrier dynamics via its effects on the occludin/zonula occludens 1 (ZO-1) protein complex mediated by focal adhesion kinase (FAK).
Su L, etal., Proc Natl Acad Sci U S A. 2011 Dec 6;108(49):19623-8. doi: 10.1073/pnas.1111414108. Epub 2011 Nov 21.
68.
Hypertension promotes phosphorylation of focal adhesion kinase and proline-rich tyrosine kinase 2 in rats: implication for the pathogenesis of hypertensive vascular disease.
Sugimura K, etal., Tohoku J Exp Med. 2010 Nov;222(3):201-10.
69.
An endogenous inhibitor of focal adhesion kinase blocks Rac1/JNK but not Ras/ERK-dependent signaling in vascular smooth muscle cells.
Sundberg LJ, etal., J Biol Chem. 2003 Aug 8;278(32):29783-91. Epub 2003 Jun 2.
70.
High glucose levels inhibit focal adhesion kinase-mediated wound healing of rat peritoneal mesothelial cells.
Tamura M, etal., Kidney Int. 2003 Feb;63(2):722-31.
71.
Activation of signaling molecules and matrix metalloproteinases in right ventricular myocardium of rats with pulmonary hypertension.
Umar S, etal., Pathol Res Pract. 2007;203(12):863-72. Epub 2007 Oct 29.
72.
Requirement for focal adhesion kinase in the early phase of mammary adenocarcinoma lung metastasis formation.
van Nimwegen MJ, etal., Cancer Res. 2005 Jun 1;65(11):4698-706.
73.
Focal adhesion kinase and protein kinase B cooperate to suppress doxorubicin-induced apoptosis of breast tumor cells.
van Nimwegen MJ, etal., Mol Pharmacol. 2006 Oct;70(4):1330-9. Epub 2006 Jul 6.
74.
Regulation of cardiac volume-sensitive chloride channel by focal adhesion kinase and Src kinase.
Walsh KB and Zhang J, Am J Physiol Heart Circ Physiol. 2005 Dec;289(6):H2566-74. Epub 2005 Jul 22.
75.
Specific induction of pp125 focal adhesion kinase in human breast cancer.
Watermann DO, etal., Br J Cancer. 2005 Sep 19;93(6):694-8.
76.
Sodium arsenite exposure alters cell migration, focal adhesion localization and decreases tyrosine phosphorylation of focal adhesion kinase in H9C2 myoblasts.
Yancy SL, etal., Toxicol Sci. 2005 Apr;84(2):278-86. Epub 2004 Nov 10.
77.
Focal adhesion kinase is required, but not sufficient, for the induction of long-term potentiation in dentate gyrus neurons in vivo.
Yang YC, etal., J Neurosci. 2003 May 15;23(10):4072-80.
78.
Nuclear compartmentalization of FAK and FRNK in cardiac myocytes.
Yi XP, etal., Am J Physiol Heart Circ Physiol. 2006 Jun;290(6):H2509-15. Epub 2005 Dec 22.
79.
Subcellular redistribution of focal adhesion kinase and its related nonkinase in hypertrophic myocardium.
Yi XP, etal., Hypertension 2003 Jun;41(6):1317-23.
80.
Activated focal adhesion kinase involved in adhesion and migration of vascular smooth muscle cells stimulated by fibronectin.
Yin H, etal., Chin Med J (Engl). 2002 Apr;115(4):494-7.
Ptk2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 107,015,730 - 107,220,865 (-) NCBI GRCr8 mRatBN7.2 7 105,126,725 - 105,331,848 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 105,126,728 - 105,331,783 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 106,875,344 - 107,035,378 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 109,096,927 - 109,256,959 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 109,044,956 - 109,204,985 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 114,436,419 - 114,611,317 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 114,437,361 - 114,590,119 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 114,371,979 - 114,525,553 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 110,933,298 - 111,084,554 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 110,967,527 - 111,118,784 (-) NCBI Celera 7 101,534,957 - 101,690,471 (-) NCBI Celera RH 3.4 Map 7 725.6 RGD Cytogenetic Map 7 q34 NCBI
PTK2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 140,657,900 - 141,002,079 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 140,657,900 - 141,002,216 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 141,667,999 - 142,012,178 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 141,737,683 - 142,080,514 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 141,737,682 - 142,080,514 NCBI Celera 8 137,836,859 - 138,179,410 (-) NCBI Celera Cytogenetic Map 8 q24.3 NCBI HuRef 8 136,979,065 - 137,322,195 (-) NCBI HuRef CHM1_1 8 141,708,729 - 142,051,666 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 141,777,902 - 142,122,150 (-) NCBI T2T-CHM13v2.0
Ptk2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 73,076,951 - 73,297,192 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 73,076,951 - 73,295,129 (-) Ensembl GRCm39 Ensembl GRCm38 15 73,205,102 - 73,423,820 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 73,205,102 - 73,423,280 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 73,035,535 - 73,253,621 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 73,032,362 - 73,221,980 (-) NCBI MGSCv36 mm8 Celera 15 74,705,367 - 74,923,905 (-) NCBI Celera Cytogenetic Map 15 D3 NCBI cM Map 15 33.94 NCBI
Ptk2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955461 14,337,914 - 14,556,931 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955461 14,337,914 - 14,622,779 (-) NCBI ChiLan1.0 ChiLan1.0
PTK2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 158,052,611 - 158,397,828 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 133,583,257 - 133,928,558 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 137,330,777 - 137,677,306 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 140,412,773 - 140,743,129 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 140,412,773 - 140,684,898 (-) Ensembl panpan1.1 panPan2
PTK2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 13 35,302,439 - 35,541,336 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 13 35,303,380 - 35,541,294 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 13 35,161,620 - 35,427,478 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 13 35,687,298 - 35,953,785 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 13 35,687,298 - 35,953,782 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 13 35,407,367 - 35,673,847 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 13 35,497,341 - 35,763,586 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 13 35,917,116 - 36,183,296 (-) NCBI UU_Cfam_GSD_1.0
Ptk2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 2,953,767 - 3,152,431 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936470 10,379,872 - 10,578,543 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936470 10,379,855 - 10,578,531 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PTK2
PTK2
Ptk2
.
Predicted Target Of
Count of predictions: 293 Count of miRNA genes: 179 Interacting mature miRNAs: 199 Transcripts: ENSRNOT00000011219 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
1300179 Kidm5 Kidney mass QTL 5 3.51 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 43747012 135012528 Rat 1331728 Bp214 Blood pressure QTL 214 2.825 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 80221299 124373579 Rat 1331731 Bp216 Blood pressure QTL 216 2.851 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 102297359 133492884 Rat 2298475 Eau6 Experimental allergic uveoretinitis QTL 6 0.0029 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 7 84257275 129257275 Rat 71114 Niddm14 Non-insulin dependent diabetes mellitus QTL 14 4.5 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 7 84257275 129257275 Rat 1357336 Gluco6 Glucose level QTL 6 3.4 blood glucose amount (VT:0000188) serum glucose level (CMO:0000543) 7 94811326 116294265 Rat 1358361 Sradr5 Stress Responsive Adrenal Weight QTL 5 5.55 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 7 43747012 108555253 Rat 1357338 Stl17 Serum triglyceride level QTL 17 3.23 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 7 69736356 112729554 Rat 631687 Hcas1 Hepatocarcinoma susceptibility QTL 1 3.9 0.001 liver integrity trait (VT:0010547) liver tumorous lesion volume to total liver volume ratio (CMO:0001082) 7 91412594 129807172 Rat 70159 Bp61 Blood pressure QTL 61 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 103146217 116738842 Rat 634331 Pia17 Pristane induced arthritis QTL 17 4.7 joint integrity trait (VT:0010548) arthritic paw count (CMO:0001460) 7 73829340 130221005 Rat 61397 Bw17 Body weight QTL 17 6.3 body mass (VT:0001259) body weight (CMO:0000012) 7 93595647 106839474 Rat 1358914 Bp266 Blood pressure QTL 266 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 83591953 134666232 Rat 631504 Cm27 Cardiac mass QTL 27 3.45 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 7 44421311 118198041 Rat 634322 Bw12 Body weight QTL 12 0 body mass (VT:0001259) body weight (CMO:0000012) 7 83153392 128153392 Rat 70173 Niddm19 Non-insulin dependent diabetes mellitus QTL 19 4.33 0.00005 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 7 64002457 135012528 Rat 1549899 Stresp8 Stress response QTL 8 4.37 0.0008 stress-related behavior trait (VT:0010451) defensive burying duration (CMO:0001961) 7 90482196 135012528 Rat 2317052 Aia17 Adjuvant induced arthritis QTL 17 2.13 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 7 81737938 126737938 Rat 631529 Tls2 T-lymphoma susceptibility QTL 2 0 0.001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 7 80221299 109401111 Rat 731176 Glom5 Glomerulus QTL 5 2.5 0.0035 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) 7 96670164 135012528 Rat 7411607 Foco15 Food consumption QTL 15 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 1558655 Swd4 Spike wave discharge measurement QTL 4 3.68 0.0002 brain electrophysiology trait (VT:0010557) brain spike-and-wave discharge severity grade (CMO:0001988) 7 86983365 131983365 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 1331768 Kidm10 Kidney mass QTL 10 4.62096 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 80221299 125221299 Rat 61357 Bp38 Blood pressure QTL 38 1.6 0.052 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 41333674 119109060 Rat 2313102 Bmd79 Bone mineral density QTL 79 2.3 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 7 94811085 116738842 Rat 731174 Uae23 Urinary albumin excretion QTL 23 2.4 0.0042 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 7 104603555 135012528 Rat 2316947 Rf58 Renal function QTL 58 7.8 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 7 68938720 113886318 Rat 1298528 Bp169 Blood pressure QTL 169 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 61074194 106074194 Rat 1331746 Kidm9 Kidney mass QTL 9 3.934 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 7 80221299 112308525 Rat 7411654 Foco25 Food consumption QTL 25 9.3 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 2316955 Stl24 Serum triglyceride level QTL 24 7.1 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 7 68938720 113886318 Rat 2299163 Iddm34 Insulin dependent diabetes mellitus QTL 34 2.71 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 7 91281130 135012528 Rat 2316952 Pur22 Proteinuria QTL 22 5.2 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 7 68938720 113886318 Rat 631540 Bw9 Body weight QTL 9 4.5 body mass (VT:0001259) body weight (CMO:0000012) 7 69736226 117455174 Rat 1358891 Bp265 Blood pressure QTL 265 2.21 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 83591953 134666232 Rat
RH139110
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 105,165,886 - 105,166,016 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,479,057 - 114,479,186 NCBI Rnor6.0 Rnor_5.0 7 114,414,617 - 114,414,746 UniSTS Rnor5.0 RGSC_v3.4 7 110,972,806 - 110,972,935 UniSTS RGSC3.4 Celera 7 101,574,059 - 101,574,188 UniSTS RH 3.4 Map 7 722.7 UniSTS Cytogenetic Map 7 q34 UniSTS
Ptk2
Rat Assembly Chr Position (strand) Source JBrowse RGSC_v3.4 7 110,933,361 - 110,933,513 UniSTS RGSC3.4 RGSC_v3.4 7 110,933,379 - 110,933,531 UniSTS RGSC3.4 Celera 7 101,535,033 - 101,535,185 UniSTS Celera 7 101,535,051 - 101,535,203 UniSTS
RH128225
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 105,126,949 - 105,127,162 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,436,644 - 114,436,856 NCBI Rnor6.0 Rnor_5.0 7 114,372,204 - 114,372,416 UniSTS Rnor5.0 RGSC_v3.4 7 110,933,510 - 110,933,722 UniSTS RGSC3.4 Celera 7 101,535,182 - 101,535,394 UniSTS RH 3.4 Map 7 721.9 UniSTS Cytogenetic Map 7 q34 UniSTS
RH130965
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 105,127,140 - 105,127,327 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,436,835 - 114,437,021 NCBI Rnor6.0 Rnor_5.0 7 114,372,395 - 114,372,581 UniSTS Rnor5.0 RGSC_v3.4 7 110,933,701 - 110,933,887 UniSTS RGSC3.4 Celera 7 101,535,373 - 101,535,559 UniSTS RH 3.4 Map 7 722.6 UniSTS Cytogenetic Map 7 q34 UniSTS
RH94436
Rat Assembly Chr Position (strand) Source JBrowse RH 3.4 Map 7 725.6 UniSTS Cytogenetic Map 7 q34 UniSTS
RH138184
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 105,230,462 - 105,230,635 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,543,607 - 114,543,779 NCBI Rnor6.0 Rnor_5.0 7 114,478,952 - 114,479,124 UniSTS Rnor5.0 RGSC_v3.4 7 111,037,952 - 111,038,124 UniSTS RGSC3.4 Celera 7 101,638,612 - 101,638,784 UniSTS RH 3.4 Map 7 722.8 UniSTS Cytogenetic Map 7 q34 UniSTS
UniSTS:143067
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 105,126,912 - 105,127,571 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,436,607 - 114,437,265 NCBI Rnor6.0 Rnor_5.0 7 114,372,167 - 114,372,825 UniSTS Rnor5.0 RGSC_v3.4 7 110,933,473 - 110,934,131 UniSTS RGSC3.4 Celera 7 101,535,145 - 101,535,803 UniSTS Cytogenetic Map 7 q34 UniSTS
PMC84535P1
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 7 107,050,309 - 107,051,293 (+) Marker Load Pipeline mRatBN7.2 7 105,161,304 - 105,162,290 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,474,476 - 114,475,460 NCBI Rnor6.0 Rnor_5.0 7 114,410,036 - 114,411,020 UniSTS Rnor5.0 RGSC_v3.4 7 110,968,225 - 110,969,209 UniSTS RGSC3.4 Celera 7 101,569,478 - 101,570,462 UniSTS Cytogenetic Map 7 q34 UniSTS
PMC84535P3
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 7 107,050,347 - 107,051,123 (+) Marker Load Pipeline mRatBN7.2 7 105,161,342 - 105,162,120 (+) MAPPER mRatBN7.2 Rnor_6.0 7 114,474,514 - 114,475,290 NCBI Rnor6.0 Rnor_5.0 7 114,410,074 - 114,410,850 UniSTS Rnor5.0 RGSC_v3.4 7 110,968,263 - 110,969,039 UniSTS RGSC3.4 Celera 7 101,569,516 - 101,570,292 UniSTS Cytogenetic Map 7 q34 UniSTS
Ptk2
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 7 114,372,073 - 114,372,225 UniSTS Rnor5.0 RGSC_v3.4 7 110,933,379 - 110,933,531 UniSTS RGSC3.4 Celera 7 101,535,051 - 101,535,203 UniSTS Cytogenetic Map 7 q34 UniSTS
Ptk2
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 7 114,372,055 - 114,372,207 UniSTS Rnor5.0 RGSC_v3.4 7 110,933,361 - 110,933,513 UniSTS RGSC3.4 Celera 7 101,535,033 - 101,535,185 UniSTS Cytogenetic Map 7 q34 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000011219 ⟹ ENSRNOP00000011219
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,956 - 105,331,763 (-) Ensembl Rnor_6.0 Ensembl 7 114,437,361 - 114,573,900 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000079599 ⟹ ENSRNOP00000075518
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,728 - 105,283,089 (-) Ensembl Rnor_6.0 Ensembl 7 114,440,949 - 114,590,119 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000095017 ⟹ ENSRNOP00000085395
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,728 - 105,283,089 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000101944 ⟹ ENSRNOP00000089674
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,956 - 105,331,763 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000109226 ⟹ ENSRNOP00000080431
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,956 - 105,331,763 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000110466 ⟹ ENSRNOP00000093819
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,243,450 - 105,331,783 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000112145 ⟹ ENSRNOP00000095122
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,728 - 105,283,089 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000113790 ⟹ ENSRNOP00000092163
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 105,126,956 - 105,331,763 (-) Ensembl
RefSeq Acc Id:
NM_013081 ⟹ NP_037213
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,730 - 107,172,091 (-) NCBI mRatBN7.2 7 105,126,725 - 105,283,089 (-) NCBI Rnor_6.0 7 114,436,419 - 114,590,208 (-) NCBI Rnor_5.0 7 114,371,979 - 114,525,553 (-) NCBI RGSC_v3.4 7 110,933,298 - 111,084,554 (-) RGD Celera 7 101,534,957 - 101,690,471 (-) NCBI
Sequence:
TAGGAACCCAGATCCATGGGGTCTCATGACTAGCTGGTTTTATCCTGTTCATTGGCTTAATCTGGCCAGGACGGTCTGTGTTTCAGATTTCGGAAGCAGAAGATTCAGTAACTGAGAGGCCACCGTGG
hide sequence
RefSeq Acc Id:
XM_039078475 ⟹ XP_038934403
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,172,005 (-) NCBI mRatBN7.2 7 105,126,725 - 105,283,003 (-) NCBI
RefSeq Acc Id:
XM_039078477 ⟹ XP_038934405
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,172,005 (-) NCBI mRatBN7.2 7 105,126,725 - 105,283,003 (-) NCBI
RefSeq Acc Id:
XM_039078480 ⟹ XP_038934408
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,172,005 (-) NCBI mRatBN7.2 7 105,126,725 - 105,283,003 (-) NCBI
RefSeq Acc Id:
XM_063263043 ⟹ XP_063119113
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263044 ⟹ XP_063119114
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,586 (-) NCBI
RefSeq Acc Id:
XM_063263045 ⟹ XP_063119115
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263046 ⟹ XP_063119116
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,586 (-) NCBI
RefSeq Acc Id:
XM_063263047 ⟹ XP_063119117
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263048 ⟹ XP_063119118
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263049 ⟹ XP_063119119
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,857 (-) NCBI
RefSeq Acc Id:
XM_063263050 ⟹ XP_063119120
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263051 ⟹ XP_063119121
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263052 ⟹ XP_063119122
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,856 (-) NCBI
RefSeq Acc Id:
XM_063263054 ⟹ XP_063119124
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,220,855 (-) NCBI
RefSeq Acc Id:
XM_063263055 ⟹ XP_063119125
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,033,181 - 107,220,862 (-) NCBI
RefSeq Acc Id:
XM_063263056 ⟹ XP_063119126
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,044,587 - 107,172,005 (-) NCBI
RefSeq Acc Id:
XM_063263057 ⟹ XP_063119127
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,089,135 (-) NCBI
RefSeq Acc Id:
XM_063263058 ⟹ XP_063119128
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,063,664 (-) NCBI
RefSeq Acc Id:
XM_063263059 ⟹ XP_063119129
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,015,959 - 107,050,982 (-) NCBI
RefSeq Acc Id:
XR_005486550
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,050,015 - 107,220,865 (-) NCBI mRatBN7.2 7 105,161,026 - 105,331,809 (-) NCBI
RefSeq Acc Id:
XR_010052943
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 107,044,517 - 107,220,865 (-) NCBI
RefSeq Acc Id:
NP_037213 ⟸ NM_013081
- UniProtKB:
Q62900 (UniProtKB/Swiss-Prot), O35346 (UniProtKB/Swiss-Prot), A0A8L2Q4U8 (UniProtKB/TrEMBL)
- Sequence:
MAAAYLDPNLNHTPSSSTKTHLGTGTERSPGAMERVLKVFHYFESSNEPTTWASIIRHGDATDVRGIIQKIVDSHKVKHVACYGFRLSHLRSEEVHWLHVDMGVSSVREKYELAHPPEEWKYELRIRY
hide sequence
Ensembl Acc Id:
ENSRNOP00000075518 ⟸ ENSRNOT00000079599
Ensembl Acc Id:
ENSRNOP00000011219 ⟸ ENSRNOT00000011219
RefSeq Acc Id:
XP_038934408 ⟸ XM_039078480
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934405 ⟸ XM_039078477
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934403 ⟸ XM_039078475
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I6A3T3 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000089674 ⟸ ENSRNOT00000101944
Ensembl Acc Id:
ENSRNOP00000095122 ⟸ ENSRNOT00000112145
Ensembl Acc Id:
ENSRNOP00000080431 ⟸ ENSRNOT00000109226
Ensembl Acc Id:
ENSRNOP00000085395 ⟸ ENSRNOT00000095017
Ensembl Acc Id:
ENSRNOP00000093819 ⟸ ENSRNOT00000110466
Ensembl Acc Id:
ENSRNOP00000092163 ⟸ ENSRNOT00000113790
RefSeq Acc Id:
XP_063119115 ⟸ XM_063263045
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6A8P2 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119121 ⟸ XM_063263051
- Peptide Label:
isoform X7
- UniProtKB:
A0A8I6AMW1 (UniProtKB/TrEMBL), A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119120 ⟸ XM_063263050
- Peptide Label:
isoform X6
- UniProtKB:
A0A0G2KAT5 (UniProtKB/TrEMBL), A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119113 ⟸ XM_063263043
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119117 ⟸ XM_063263047
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6A8P2 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119118 ⟸ XM_063263048
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6A8P2 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119119 ⟸ XM_063263049
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6A8P2 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119122 ⟸ XM_063263052
- Peptide Label:
isoform X8
- UniProtKB:
A0A8I6AH25 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119124 ⟸ XM_063263054
- Peptide Label:
isoform X9
- UniProtKB:
A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119116 ⟸ XM_063263046
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6A8P2 (UniProtKB/TrEMBL), A0A8L2Q4U8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119114 ⟸ XM_063263044
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6A3T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119127 ⟸ XM_063263057
- Peptide Label:
isoform X12
RefSeq Acc Id:
XP_063119128 ⟸ XM_063263058
- Peptide Label:
isoform X13
RefSeq Acc Id:
XP_063119129 ⟸ XM_063263059
- Peptide Label:
isoform X13
RefSeq Acc Id:
XP_063119125 ⟸ XM_063263055
- Peptide Label:
isoform X10
- UniProtKB:
A6HRV3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063119126 ⟸ XM_063263056
- Peptide Label:
isoform X11
BioCyc Gene G2FUF-33063 BioCyc
Ensembl Genes ENSRNOG00000007916 Ensembl, ENTREZGENE
Ensembl Transcript ENSRNOT00000079599 ENTREZGENE
ENSRNOT00000101944 ENTREZGENE
ENSRNOT00000112145 ENTREZGENE
ENSRNOT00000113790 ENTREZGENE
Gene3D-CATH 1.20.80.10 UniProtKB/Swiss-Prot
2.30.29.30 UniProtKB/Swiss-Prot
Nucleotidyltransferases domain 2 UniProtKB/Swiss-Prot
Phosphatidylinositol 3-kinase Catalytic Subunit, Chain A, domain 1 UniProtKB/Swiss-Prot
Phosphorylase Kinase, domain 1 UniProtKB/Swiss-Prot
Single helix bin UniProtKB/Swiss-Prot
Transferase(Phosphotransferase) domain 1 UniProtKB/Swiss-Prot
InterPro Band_41_domain UniProtKB/Swiss-Prot
FADK_N UniProtKB/Swiss-Prot
FAK1-like_FERM_C UniProtKB/Swiss-Prot
FAK1/PYK2_FERM_C UniProtKB/Swiss-Prot
FERM/acyl-CoA-bd_prot_sf UniProtKB/Swiss-Prot
FERM_2 UniProtKB/Swiss-Prot
FERM_central UniProtKB/Swiss-Prot
FERM_domain UniProtKB/Swiss-Prot
Focal_adhe_kin_target_dom_sf UniProtKB/Swiss-Prot
Focal_adhesion_kin_target_dom UniProtKB/Swiss-Prot
Kinase-like_dom_sf UniProtKB/Swiss-Prot
PH-like_dom_sf UniProtKB/Swiss-Prot
Prot_kinase_dom UniProtKB/Swiss-Prot
Protein_kinase_ATP_BS UniProtKB/Swiss-Prot
Ser-Thr/Tyr_kinase_cat_dom UniProtKB/Swiss-Prot
Tyr_kinase_AS UniProtKB/Swiss-Prot
Tyr_kinase_cat_dom UniProtKB/Swiss-Prot
Ubiquitin-like_domsf UniProtKB/Swiss-Prot
KEGG Report rno:25614 UniProtKB/Swiss-Prot
NCBI Gene 25614 ENTREZGENE
PANTHER FERM AND PDZ DOMAIN-CONTAINING PROTEIN FAMILY MEMBER UniProtKB/Swiss-Prot
NON-SPECIFIC PROTEIN-TYROSINE KINASE UniProtKB/Swiss-Prot
Pfam FERM_C_FAK1 UniProtKB/Swiss-Prot
FERM_M UniProtKB/Swiss-Prot
FERM_N_2 UniProtKB/Swiss-Prot
Focal_AT UniProtKB/Swiss-Prot
Pkinase_Tyr UniProtKB/Swiss-Prot
PhenoGen Ptk2 PhenoGen
PRINTS TYRKINASE UniProtKB/Swiss-Prot
PROSITE FERM_2 UniProtKB/Swiss-Prot
FERM_3 UniProtKB/Swiss-Prot
PROTEIN_KINASE_ATP UniProtKB/Swiss-Prot
PROTEIN_KINASE_DOM UniProtKB/Swiss-Prot
PROTEIN_KINASE_TYR UniProtKB/Swiss-Prot
RatGTEx ENSRNOG00000007916 RatGTEx
SMART B41 UniProtKB/Swiss-Prot
TyrKc UniProtKB/Swiss-Prot
Superfamily-SCOP PH domain-like UniProtKB/Swiss-Prot
SSF47031 UniProtKB/Swiss-Prot
SSF54236 UniProtKB/Swiss-Prot
SSF56112 UniProtKB/Swiss-Prot
SSF68993 UniProtKB/Swiss-Prot
UniProt A0A0G2KAT5 ENTREZGENE, UniProtKB/TrEMBL
A0A8I5ZQM0_RAT UniProtKB/TrEMBL
A0A8I6A3T3 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6A8P2 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6AH25 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6AJL3_RAT UniProtKB/TrEMBL
A0A8I6AMW1 ENTREZGENE, UniProtKB/TrEMBL
A0A8L2Q4U8 ENTREZGENE, UniProtKB/TrEMBL
A6HRV3 ENTREZGENE, UniProtKB/TrEMBL
A6HRV4_RAT UniProtKB/TrEMBL
A6HRV5_RAT UniProtKB/TrEMBL
FAK1_RAT UniProtKB/Swiss-Prot, ENTREZGENE
Q62900 ENTREZGENE
UniProt Secondary Q62900 UniProtKB/Swiss-Prot
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-02-28
Ptk2
protein tyrosine kinase 2
Ptk2
PTK2 protein tyrosine kinase 2
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-09-10
Ptk2
PTK2 protein tyrosine kinase 2
protein tyrosine kinase 2
Name updated
1299863 APPROVED
2002-06-10
Ptk2
Protein tyrosine kinase
Symbol and Name status set to approved
70586 APPROVED
