Symbol:
Mas1
Name:
MAS1 proto-oncogene, G protein-coupled receptor
RGD ID:
3049
Description:
Predicted to enable angiotensin receptor activity and peptide binding activity. Involved in several processes, including hippocampus development; male gonad development; and regulation of primary metabolic process. Located in cell surface. Used to study glaucoma and hypertension. Biomarker of chronic kidney disease; congestive heart failure; dilated cardiomyopathy; and primary biliary cholangitis. Orthologous to human MAS1 (MAS1 proto-oncogene, G protein-coupled receptor); PARTICIPATES IN angiotensin (1-7) signaling pathway; renin-angiotensin cascade pathway; INTERACTS WITH 17beta-estradiol; 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
angiotensin-(1-7) receptor; c-mas; MAS proto-oncogene; Mas-related G protein-coupled receptor a; MAS1 oncogene; Mgra; proto-oncogene Mas
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor) HGNC
Ensembl, HomoloGene, Inparanoid, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Mas1 (MAS1 oncogene) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Mas1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Mas1 (MAS1 proto-oncogene, G protein-coupled receptor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
MAS1L (MAS1 proto-oncogene like, G protein-coupled receptor) HGNC
Panther
Alliance orthologs 3
Homo sapiens (human):
MAS1 (MAS1 proto-oncogene, G protein-coupled receptor)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Mas1 (MAS1 oncogene)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
mas1l
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
mas1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Allele / Splice:
Mas1em1Mcwi
Genetic Models:
SS-Mas1em1Mcwi
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 50,428,064 - 50,459,537 (+) NCBI GRCr8 mRatBN7.2 1 47,879,956 - 47,911,500 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 47,880,309 - 47,911,709 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 48,571,963 - 48,603,158 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 54,557,771 - 54,588,840 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 48,647,488 - 48,678,679 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 48,076,761 - 48,108,218 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 48,077,033 - 48,108,216 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 51,644,462 - 51,675,365 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 42,154,786 - 42,185,750 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 42,157,730 - 42,188,693 (+) NCBI Celera 1 43,680,754 - 43,711,122 (+) NCBI Celera RH 3.4 Map 1 544.2 RGD Cytogenetic Map 1 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mas1 Rat 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in increased expression of MAS1 mRNA CTD PMID:26496021 Mas1 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Mas1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Mas1 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression EXP 6480464 2 more ... CTD PMID:27291303 Mas1 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Mas1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Mas1 Rat 2,3',4,4',5-Pentachlorobiphenyl decreases expression ISO Mas1 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Mas1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of MAS1 mRNA CTD PMID:32109520 Mas1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of MAS1 mRNA CTD PMID:25825206 Mas1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of MAS1 mRNA CTD PMID:33150595 Mas1 Rat 6-propyl-2-thiouracil increases methylation EXP 6480464 Propylthiouracil results in increased methylation of MAS1 promoter CTD PMID:33150595 Mas1 Rat Ac-Ser-Asp-Lys-Pro-OH multiple interactions ISO Mas1 (Mus musculus) 6480464 ACE2 protein affects the reaction [goralatide inhibits the reaction [AGT protein results in decreased expression of MAS1 protein]] more ... CTD PMID:33007385 Mas1 Rat aldehydo-D-glucose decreases expression ISO Mas1 (Mus musculus) 6480464 Glucose results in decreased expression of MAS1 protein CTD PMID:29266779 Mas1 Rat aldehydo-D-glucose multiple interactions ISO Mas1 (Mus musculus) 6480464 CEBPB protein inhibits the reaction [Glucose results in decreased expression of MAS1 protein] CTD PMID:29266779 Mas1 Rat aldehydo-D-glucose decreases expression EXP 6480464 Glucose results in decreased expression of MAS1 mRNA CTD PMID:29211853 Mas1 Rat aldehydo-D-glucose multiple interactions EXP 6480464 NFE2L2 protein affects the reaction [Glucose results in decreased expression of MAS1 mRNA] more ... CTD PMID:29211853 Mas1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of MAS1 mRNA CTD PMID:16483693 Mas1 Rat arsane decreases expression ISO Mas1 (Mus musculus) 6480464 Arsenic results in decreased expression of MAS1 mRNA CTD PMID:36669534 Mas1 Rat arsane multiple interactions ISO MAS1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 protein CTD PMID:36669534 Mas1 Rat arsenic atom multiple interactions ISO MAS1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 protein CTD PMID:36669534 Mas1 Rat arsenic atom decreases expression ISO Mas1 (Mus musculus) 6480464 Arsenic results in decreased expression of MAS1 mRNA CTD PMID:36669534 Mas1 Rat benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of MAS1 mRNA CTD PMID:21839799 Mas1 Rat benzo[a]pyrene affects methylation ISO MAS1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of MAS1 promoter CTD PMID:27901495 Mas1 Rat Benzo[k]fluoranthene increases expression ISO Mas1 (Mus musculus) 6480464 benzo(k)fluoranthene results in increased expression of MAS1 mRNA CTD PMID:26377693 Mas1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in increased expression of MAS1 mRNA CTD PMID:26496021 Mas1 Rat bisphenol A decreases expression ISO Mas1 (Mus musculus) 6480464 bisphenol A results in decreased expression of MAS1 mRNA CTD PMID:32156529 Mas1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MAS1 mRNA CTD PMID:30816183 and PMID:32528016 Mas1 Rat cadmium dichloride decreases expression ISO Mas1 (Mus musculus) 6480464 Cadmium Chloride results in decreased expression of MAS1 mRNA CTD PMID:24982889 Mas1 Rat cadmium dichloride increases expression ISO MAS1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of MAS1 mRNA CTD PMID:38568856 Mas1 Rat Candesartan cilexetil increases expression EXP 6480464 candesartan cilexetil results in increased expression of MAS1 protein CTD PMID:22120037 Mas1 Rat captopril multiple interactions ISO Mas1 (Mus musculus) 6480464 Captopril inhibits the reaction [AGT protein results in decreased expression of MAS1 protein] and Captopril inhibits the reaction [Silicon Dioxide results in decreased expression of MAS1 protein] CTD PMID:33007385 Mas1 Rat captopril multiple interactions EXP 6480464 Captopril inhibits the reaction [Pregabalin results in decreased expression of MAS1 protein] CTD PMID:31629013 Mas1 Rat chlorpyrifos decreases methylation EXP 6480464 Chlorpyrifos results in decreased methylation of MAS1 gene CTD PMID:32905263 Mas1 Rat choline multiple interactions ISO Mas1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MAS1 mRNA CTD PMID:20938992 Mas1 Rat clozapine decreases expression EXP 6480464 Clozapine results in decreased expression of MAS1 mRNA CTD PMID:16715494 Mas1 Rat cyclosporin A increases methylation ISO MAS1 (Homo sapiens) 6480464 Cyclosporine results in increased methylation of MAS1 promoter CTD PMID:27989131 Mas1 Rat D-glucose decreases expression EXP 6480464 Glucose results in decreased expression of MAS1 mRNA CTD PMID:29211853 Mas1 Rat D-glucose decreases expression ISO Mas1 (Mus musculus) 6480464 Glucose results in decreased expression of MAS1 protein CTD PMID:29266779 Mas1 Rat D-glucose multiple interactions ISO Mas1 (Mus musculus) 6480464 CEBPB protein inhibits the reaction [Glucose results in decreased expression of MAS1 protein] CTD PMID:29266779 Mas1 Rat D-glucose multiple interactions EXP 6480464 NFE2L2 protein affects the reaction [Glucose results in decreased expression of MAS1 mRNA] more ... CTD PMID:29211853 Mas1 Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of MAS1 mRNA CTD PMID:23640034 Mas1 Rat dimethylarsinic acid decreases expression ISO Mas1 (Mus musculus) 6480464 Cacodylic Acid results in decreased expression of MAS1 mRNA CTD PMID:22246474 Mas1 Rat diminazene diaceturate increases expression ISO Mas1 (Mus musculus) 6480464 diminazene aceturate results in increased expression of MAS1 protein CTD PMID:31982938 Mas1 Rat ethanol decreases expression EXP 6480464 Ethanol results in decreased expression of MAS1 mRNA CTD PMID:29548890 Mas1 Rat ethanol affects expression ISO Mas1 (Mus musculus) 6480464 Ethanol affects the expression of MAS1 mRNA CTD PMID:30319688 Mas1 Rat fentanyl decreases expression EXP 6480464 Fentanyl results in decreased expression of MAS1 mRNA CTD PMID:36032789 Mas1 Rat folic acid multiple interactions ISO Mas1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MAS1 mRNA CTD PMID:20938992 Mas1 Rat genistein increases expression ISO Mas1 (Mus musculus) 6480464 Genistein results in increased expression of MAS1 mRNA CTD PMID:32186404 Mas1 Rat glucose multiple interactions ISO Mas1 (Mus musculus) 6480464 CEBPB protein inhibits the reaction [Glucose results in decreased expression of MAS1 protein] CTD PMID:29266779 Mas1 Rat glucose decreases expression ISO Mas1 (Mus musculus) 6480464 Glucose results in decreased expression of MAS1 protein CTD PMID:29266779 Mas1 Rat glucose multiple interactions EXP 6480464 NFE2L2 protein affects the reaction [Glucose results in decreased expression of MAS1 mRNA] more ... CTD PMID:29211853 Mas1 Rat glucose decreases expression EXP 6480464 Glucose results in decreased expression of MAS1 mRNA CTD PMID:29211853 Mas1 Rat glycidol decreases expression EXP 6480464 glycidol results in decreased expression of MAS1 mRNA CTD PMID:33150645 Mas1 Rat glycidol increases methylation EXP 6480464 glycidol results in increased methylation of MAS1 promoter CTD PMID:33150595 Mas1 Rat glyphosate decreases expression ISO Mas1 (Mus musculus) 6480464 Glyphosate results in decreased expression of MAS1 mRNA CTD PMID:36608876 Mas1 Rat goralatide multiple interactions ISO Mas1 (Mus musculus) 6480464 ACE2 protein affects the reaction [goralatide inhibits the reaction [AGT protein results in decreased expression of MAS1 protein]] more ... CTD PMID:33007385 Mas1 Rat haloperidol decreases expression EXP 6480464 Haloperidol results in decreased expression of MAS1 mRNA CTD PMID:16715494 Mas1 Rat hydralazine multiple interactions ISO MAS1 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of MAS1 mRNA CTD PMID:17183730 Mas1 Rat indoxyl sulfate decreases expression EXP 401793742 indoxyl sulfate decreases expression of Mas1 protein in rat kidney RGD Mas1 Rat isoprenaline decreases expression EXP 6480464 Isoproterenol results in decreased expression of MAS1 protein CTD PMID:20409916 Mas1 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of MAS1 mRNA CTD PMID:20080153 Mas1 Rat L-methionine multiple interactions ISO Mas1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MAS1 mRNA CTD PMID:20938992 Mas1 Rat lipopolysaccharide multiple interactions EXP 6480464 2-(1-carboxy-2-(3-(3 more ... CTD PMID:27302421 Mas1 Rat lipopolysaccharide increases expression ISO MAS1 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of MAS1 mRNA CTD PMID:35811015 Mas1 Rat lipopolysaccharide multiple interactions ISO MAS1 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Mas1 Rat lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of MAS1 mRNA CTD PMID:27302421 Mas1 Rat lipoxin A4 multiple interactions ISO Mas1 (Mus musculus) 6480464 2-(1-carboxy-2-(3-(3 more ... CTD PMID:29969931 Mas1 Rat losartan multiple interactions ISO Mas1 (Mus musculus) 6480464 Losartan inhibits the reaction [AGT protein results in decreased expression of MAS1 protein] and Losartan inhibits the reaction [Silicon Dioxide results in decreased expression of MAS1 protein] CTD PMID:33007385 Mas1 Rat N-methylnicotinate multiple interactions ISO Mas1 (Mus musculus) 6480464 oltipraz affects the reaction [trigonelline affects the reaction [INS2 protein affects the expression of MAS1 mRNA]] more ... CTD PMID:29211853 Mas1 Rat N-methylnicotinate multiple interactions EXP 6480464 oltipraz inhibits the reaction [trigonelline inhibits the reaction [Glucose results in decreased expression of MAS1 mRNA]] and trigonelline inhibits the reaction [Glucose results in decreased expression of MAS1 mRNA] CTD PMID:29211853 Mas1 Rat olmesartan increases expression EXP 6480464 olmesartan results in increased expression of MAS1 mRNA and olmesartan results in increased expression of MAS1 protein CTD PMID:28656296 Mas1 Rat oltipraz multiple interactions ISO Mas1 (Mus musculus) 6480464 oltipraz affects the reaction [trigonelline affects the reaction [INS2 protein affects the expression of MAS1 mRNA]] and oltipraz affects the reaction [trigonelline affects the reaction [INS2 protein affects the expression of MAS1 protein]] CTD PMID:29211853 Mas1 Rat oltipraz multiple interactions EXP 6480464 oltipraz inhibits the reaction [trigonelline inhibits the reaction [Glucose results in decreased expression of MAS1 mRNA]] CTD PMID:29211853 Mas1 Rat paracetamol affects expression ISO Mas1 (Mus musculus) 6480464 Acetaminophen affects the expression of MAS1 mRNA CTD PMID:17562736 Mas1 Rat paraquat affects expression EXP 6480464 Paraquat affects the expression of MAS1 mRNA CTD PMID:15206577 Mas1 Rat PCB138 multiple interactions ISO Mas1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Mas1 Rat perindopril multiple interactions EXP 6480464 Perindopril promotes the reaction [Carbon Tetrachloride results in increased expression of MAS1 mRNA] CTD PMID:19793108 Mas1 Rat pirinixic acid decreases expression ISO Mas1 (Mus musculus) 6480464 pirinixic acid results in decreased expression of MAS1 mRNA CTD PMID:20813756 Mas1 Rat pregabalin multiple interactions EXP 6480464 Captopril inhibits the reaction [Pregabalin results in decreased expression of MAS1 protein] and Telmisartan inhibits the reaction [Pregabalin results in decreased expression of MAS1 protein] CTD PMID:31629013 Mas1 Rat pregabalin decreases expression EXP 6480464 Pregabalin results in decreased expression of MAS1 protein CTD PMID:31629013 Mas1 Rat rotenone multiple interactions ISO Mas1 (Mus musculus) 6480464 7-Ala-angiotensin (1-7) inhibits the reaction [angiotensin I (1-7) promotes the reaction [Rotenone results in increased expression of MAS1 mRNA]] more ... CTD PMID:29665408 Mas1 Rat rotenone increases expression ISO Mas1 (Mus musculus) 6480464 Rotenone results in increased expression of MAS1 mRNA and Rotenone results in increased expression of MAS1 protein CTD PMID:29665408 Mas1 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO MAS1 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Mas1 Rat silicon dioxide multiple interactions ISO Mas1 (Mus musculus) 6480464 ACE protein affects the reaction [Silicon Dioxide results in decreased expression of MAS1 protein] more ... CTD PMID:33007385 Mas1 Rat silicon dioxide decreases expression ISO Mas1 (Mus musculus) 6480464 Silicon Dioxide results in decreased expression of MAS1 protein CTD PMID:33007385 Mas1 Rat sodium arsenite multiple interactions ISO MAS1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of MAS1 protein CTD PMID:36669534 Mas1 Rat sodium arsenite decreases expression ISO Mas1 (Mus musculus) 6480464 sodium arsenite results in decreased expression of MAS1 mRNA CTD PMID:37682722 Mas1 Rat streptozocin decreases expression ISO Mas1 (Mus musculus) 6480464 Streptozocin results in decreased expression of MAS1 protein CTD PMID:21381899 and PMID:29266779 Mas1 Rat streptozocin multiple interactions ISO Mas1 (Mus musculus) 6480464 CEBPB protein inhibits the reaction [Streptozocin results in decreased expression of MAS1 protein] and Telmisartan inhibits the reaction [Streptozocin results in decreased expression of MAS1 protein] CTD PMID:21381899 and PMID:29266779 Mas1 Rat tamoxifen decreases expression ISO Mas1 (Mus musculus) 6480464 Tamoxifen results in decreased expression of MAS1 mRNA CTD PMID:25123088 Mas1 Rat telmisartan multiple interactions ISO Mas1 (Mus musculus) 6480464 telmisartan inhibits the reaction [Streptozocin results in decreased expression of MAS1 protein] CTD PMID:21381899 Mas1 Rat telmisartan increases expression EXP 6480464 Telmisartan results in increased expression of MAS1 protein CTD PMID:28656296 Mas1 Rat telmisartan multiple interactions EXP 6480464 Telmisartan inhibits the reaction [Pregabalin results in decreased expression of MAS1 protein] CTD PMID:31629013 Mas1 Rat tert-butyl hydroperoxide decreases methylation ISO MAS1 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased methylation of MAS1 gene CTD PMID:29432895 Mas1 Rat tetrachloroethene decreases expression ISO Mas1 (Mus musculus) 6480464 Tetrachloroethylene results in decreased expression of MAS1 mRNA CTD PMID:28973375 Mas1 Rat tetrachloromethane multiple interactions EXP 6480464 Perindopril promotes the reaction [Carbon Tetrachloride results in increased expression of MAS1 mRNA] CTD PMID:19793108 Mas1 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of MAS1 mRNA CTD PMID:19793108 Mas1 Rat trichloroethene increases expression ISO Mas1 (Mus musculus) 6480464 Trichloroethylene results in increased expression of MAS1 mRNA CTD PMID:25549359 Mas1 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of MAS1 mRNA CTD PMID:33387578 Mas1 Rat triptonide increases expression ISO Mas1 (Mus musculus) 6480464 triptonide results in increased expression of MAS1 mRNA CTD PMID:33045310 Mas1 Rat valproic acid affects expression ISO Mas1 (Mus musculus) 6480464 Valproic Acid affects the expression of MAS1 mRNA CTD PMID:17292431 Mas1 Rat valproic acid multiple interactions ISO MAS1 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of MAS1 mRNA CTD PMID:17183730 Mas1 Rat zearalenone increases expression ISO Mas1 (Mus musculus) 6480464 Zearalenone results in increased expression of MAS1 mRNA CTD PMID:24412631
Imported Annotations - KEGG (archival)
17beta-estradiol (EXP) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 6-propyl-2-thiouracil (EXP) Ac-Ser-Asp-Lys-Pro-OH (ISO) aldehydo-D-glucose (EXP,ISO) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) benzo[a]pyrene (EXP,ISO) Benzo[k]fluoranthene (ISO) bisphenol A (EXP,ISO) cadmium dichloride (ISO) Candesartan cilexetil (EXP) captopril (EXP,ISO) chlorpyrifos (EXP) choline (ISO) clozapine (EXP) cyclosporin A (ISO) D-glucose (EXP,ISO) decabromodiphenyl ether (EXP) dimethylarsinic acid (ISO) diminazene diaceturate (ISO) ethanol (EXP,ISO) fentanyl (EXP) folic acid (ISO) genistein (ISO) glucose (EXP,ISO) glycidol (EXP) glyphosate (ISO) goralatide (ISO) haloperidol (EXP) hydralazine (ISO) indoxyl sulfate (EXP) isoprenaline (EXP) ketamine (EXP) L-methionine (ISO) lipopolysaccharide (EXP,ISO) lipoxin A4 (ISO) losartan (ISO) N-methylnicotinate (EXP,ISO) olmesartan (EXP) oltipraz (EXP,ISO) paracetamol (ISO) paraquat (EXP) PCB138 (ISO) perindopril (EXP) pirinixic acid (ISO) pregabalin (EXP) rotenone (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) silicon dioxide (ISO) sodium arsenite (ISO) streptozocin (ISO) tamoxifen (ISO) telmisartan (EXP,ISO) tert-butyl hydroperoxide (ISO) tetrachloroethene (ISO) tetrachloromethane (EXP) trichloroethene (EXP,ISO) triptonide (ISO) valproic acid (ISO) zearalenone (ISO)
1.
Candesartan cilexetil protects from cardiac myosin induced cardiotoxicity via reduction of endoplasmic reticulum stress and apoptosis in rats: involvement of ACE2-Ang (1-7)-mas axis.
Arumugam S, etal., Toxicology. 2012 Jan 27;291(1-3):139-45. doi: 10.1016/j.tox.2011.11.008. Epub 2011 Nov 23.
2.
Telmisartan Prevents Alveolar Bone Loss by Decreasing the Expression of Osteoclasts Markers in Hypertensive Rats With Periodontal Disease.
Brito VGB, etal., Front Pharmacol. 2020 Nov 11;11:579926. doi: 10.3389/fphar.2020.579926. eCollection 2020.
3.
Chronic infusion of angiotensin receptor antagonists in the hypothalamic paraventricular nucleus prevents hypertension in a rat model of sleep apnea.
da Silva AQ, etal., Brain Res. 2011 Jan 12;1368:231-8. Epub 2010 Oct 30.
4.
Selective increase of angiotensin(1-7) and its receptor in hearts of spontaneously hypertensive rats subjected to physical training.
Filho AG, etal., Exp Physiol. 2008 May;93(5):589-98.
5.
Antiglaucomatous effects of the activation of intrinsic Angiotensin-converting enzyme 2.
Foureaux G, etal., Invest Ophthalmol Vis Sci. 2013 Jun 21;54(6):4296-306. doi: 10.1167/iovs.12-11427.
6.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
7.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
8.
Upregulation of hepatic angiotensin-converting enzyme 2 (ACE2) and angiotensin-(1-7) levels in experimental biliary fibrosis.
Herath CB, etal., J Hepatol. 2007 Sep;47(3):387-95. Epub 2007 Apr 2.
9.
Maternal Tryptophan Supplementation Protects Adult Rat Offspring against Hypertension Programmed by Maternal Chronic Kidney Disease: Implication of Tryptophan-Metabolizing Microbiome and Aryl Hydrocarbon Receptor.
Hsu CN, etal., Int J Mol Sci. 2020 Jun 26;21(12):4552. doi: 10.3390/ijms21124552.
10.
Upregulation Of Angiotensin Converting Enzyme 2 In Hepatic Fibrosis By Angiotensin Converting Enzyme Inhibitors: An In Vivo And In Vitro Study.
Huang ML, etal., Clin Exp Pharmacol Physiol. 2009 Sep 28.
11.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
12.
The role of angiotensin-(1-7) receptor Mas in spermatogenesis in mice and rats.
Leal MC, etal., J Anat. 2009 May;214(5):736-43.
13.
The mas proto-oncogene is developmentally regulated in the rat central nervous system.
Martin KA, etal., Brain Res Dev Brain Res. 1992 Jul 24;68(1):75-82.
14.
Expression of the mouse and rat mas proto-oncogene in the brain and peripheral tissues.
Metzger R, etal., FEBS Lett. 1995 Jan 2;357(1):27-32.
15.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
16.
Renal ACE and ACE2 expression in early diabetic rats.
Moon JY, etal., Nephron Exp Nephrol. 2008;110(1):e8-e16. Epub 2008 Aug 4.
17.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
18.
Indoxyl sulfate downregulates expression of Mas receptor via OAT3/AhR/Stat3 pathway in proximal tubular cells.
Ng HY, etal., PLoS One. 2014 Mar 10;9(3):e91517. doi: 10.1371/journal.pone.0091517. eCollection 2014.
19.
Gonadotropin Stimulation Increases the Expression of Angiotensin-(1-7) and Mas Receptor in the Rat Ovary.
Pereira VM, etal., Reprod Sci. 2009 Aug 24.
20.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
21.
The renin-angiotensin system: peptides and enzymes beyond angiotensin II.
Reudelhuber TL Curr Opin Nephrol Hypertens. 2005 Mar;14(2):155-9.
22.
A place in our hearts for the lowly angiotensin 1-7 peptide?
Reudelhuber TL Hypertension. 2006 May;47(5):811-5. Epub 2006 Mar 6.
23.
GOA pipeline
RGD automated data pipeline
24.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
25.
Comprehensive gene review and curation
RGD comprehensive gene curation
26.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
27.
Angiotensin-(1-7) inhibits growth of cardiac myocytes through activation of the mas receptor.
Tallant EA, etal., Am J Physiol Heart Circ Physiol. 2005 Oct;289(4):H1560-6. Epub 2005 Jun 10.
28.
Tentative Sequence Identification Numbers
Tentative Sequence Data IDs. TIGR Gene Index, Rat Data
29.
Reduction in renal ACE2 expression in subtotal nephrectomy is ameliorated with ACE inhibition.
Velkoska E, etal., Clin Sci (Lond). 2009 Aug 21.
30.
Sustained long term potentiation and anxiety in mice lacking the Mas protooncogene.
Walther T, etal., J Biol Chem 1998 May 8;273(19):11867-73.
31.
Effects of angiotensin II on proximal tubular cells stably transfected with the c-mas oncogene.
Wolf G and Neilson EG, Am J Physiol. 1992 Nov;263(5 Pt 2):F931-8.
32.
Counteraction between angiotensin II and angiotensin-(1-7) via activating angiotensin type I and Mas receptor on rat renal mesangial cells.
Xue H, etal., Regul Pept. 2012 Aug 20;177(1-3):12-20. doi: 10.1016/j.regpep.2012.04.002. Epub 2012 May 1.
33.
Characterization of the rat mas oncogene and its high-level expression in the hippocampus and cerebral cortex of rat brain.
Young D, etal., Proc Natl Acad Sci U S A 1988 Jul;85(14):5339-42.
34.
Regulation of angiotensin-(1-7) and angiotensin II type 1 receptor by telmisartan and losartan in adriamycin-induced rat heart failure.
Zong WN, etal., Acta Pharmacol Sin. 2011 Nov;32(11):1345-50. doi: 10.1038/aps.2011.96. Epub 2011 Oct 3.
35.
Atypical expansion in mice of the sensory neuron-specific Mrg G protein-coupled receptor family.
Zylka MJ, etal., Proc Natl Acad Sci U S A 2003 Aug 19;100(17):10043-8. Epub 2003 Aug 8.
Mas1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 50,428,064 - 50,459,537 (+) NCBI GRCr8 mRatBN7.2 1 47,879,956 - 47,911,500 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 47,880,309 - 47,911,709 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 48,571,963 - 48,603,158 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 54,557,771 - 54,588,840 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 48,647,488 - 48,678,679 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 48,076,761 - 48,108,218 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 48,077,033 - 48,108,216 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 51,644,462 - 51,675,365 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 42,154,786 - 42,185,750 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 42,157,730 - 42,188,693 (+) NCBI Celera 1 43,680,754 - 43,711,122 (+) NCBI Celera RH 3.4 Map 1 544.2 RGD Cytogenetic Map 1 q11 NCBI
MAS1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 159,888,787 - 159,917,447 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 159,890,988 - 159,917,447 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 160,312,020 - 160,338,479 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 160,247,964 - 160,249,098 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 160,298,384 - 160,299,519 NCBI Celera 6 160,974,252 - 160,975,386 (+) NCBI Celera Cytogenetic Map 6 q25.3 NCBI HuRef 6 157,798,119 - 157,799,253 (+) NCBI HuRef CHM1_1 6 160,590,238 - 160,591,372 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 161,134,461 - 161,165,992 (+) NCBI T2T-CHM13v2.0
Mas1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 13,056,981 - 13,087,037 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 13,059,966 - 13,087,030 (-) Ensembl GRCm39 Ensembl GRCm38 17 12,838,841 - 12,868,150 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 12,841,079 - 12,868,143 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 13,033,871 - 13,061,009 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 12,684,009 - 12,711,075 (-) NCBI MGSCv36 mm8 Celera 17 12,872,985 - 12,900,041 (-) NCBI Celera Cytogenetic Map 17 A1 NCBI cM Map 17 8.69 NCBI
Mas1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955439 20,956,862 - 20,957,839 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955439 20,956,862 - 20,957,839 (-) NCBI ChiLan1.0 ChiLan1.0
MAS1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 179,989,640 - 180,015,684 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 177,894,549 - 177,920,364 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 157,774,098 - 157,799,983 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 162,785,263 - 162,802,530 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 162,801,416 - 162,802,393 (+) Ensembl panpan1.1 panPan2
MAS1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 49,090,041 - 49,105,244 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 49,090,041 - 49,105,244 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 49,931,512 - 49,946,711 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 49,272,721 - 49,299,228 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 49,274,155 - 49,289,356 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 49,156,624 - 49,171,810 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 49,028,114 - 49,043,315 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 49,643,019 - 49,658,218 (+) NCBI UU_Cfam_GSD_1.0
MAS1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 7,527,861 - 7,528,838 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 7,527,566 - 7,542,110 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 9,326,523 - 9,339,701 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MAS1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 13 87,520,860 - 87,523,523 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 13 87,521,947 - 87,523,098 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 59,898,097 - 59,920,293 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mas1
.
Predicted Target Of
Count of predictions: 149 Count of miRNA genes: 121 Interacting mature miRNAs: 132 Transcripts: ENSRNOT00000020100 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
1331732 Srn4 Serum renin concentration QTL 4 4.467 renin activity (VT:0005581) plasma renin activity level (CMO:0000116) 1 35239598 78430678 Rat 2313059 Bss55 Bone structure and strength QTL 55 3.2 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1357397 Bw41 Body weight QTL 41 4.19 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 1 22340647 49361612 Rat 1358359 Sradr1 Stress Responsive Adrenal Weight QTL 1 4.74 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 30882023 123479925 Rat 1331792 Rf29 Renal function QTL 29 4.589 urine potassium amount (VT:0010539) urine potassium level (CMO:0000128) 1 35239598 78430678 Rat 2313062 Bmd73 Bone mineral density QTL 73 3.9 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 11481312 82174945 Rat 8552900 Pigfal1 Plasma insulin-like growth factor 1 level QTL 1 7.4 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 1554320 Bmd1 Bone mineral density QTL 1 12.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 509108 86060548 Rat 1354643 Foco2 Food consumption QTL 2 7.17 0.0001 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 1 33449848 78449848 Rat 2302059 Pia36 Pristane induced arthritis QTL 36 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 43333002 88333002 Rat 2313065 Bss67 Bone structure and strength QTL 67 3.1 0.0001 tibia area (VT:1000281) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 7421626 Bp360 Blood pressure QTL 360 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 4393289 49393289 Rat 1357400 Bw62 Body weight QTL62 4.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 1 22340647 67340647 Rat 1357401 Bw43 Body weight QTL 43 3.75 body mass (VT:0001259) body weight (CMO:0000012) 1 22340647 49361612 Rat 2313069 Bss68 Bone structure and strength QTL 68 2.9 0.0001 tibia size trait (VT:0100001) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 631494 Bp95 Blood pressure QTL 95 40 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 16206210 49268520 Rat 2313075 Bss66 Bone structure and strength QTL 66 3.4 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 11481312 82174945 Rat 5684998 Bss101 Bone structure and strength QTL 101 3.6 tibia strength trait (VT:1000284) tibia ultimate force (CMO:0001734) 1 15431621 49361612 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 5684999 Bss102 Bone structure and strength QTL 102 5.5 7e-07 tibia strength trait (VT:1000284) tibia stiffness (CMO:0001735) 1 15431621 49361612 Rat 2313072 Bss53 Bone structure and strength QTL 53 4.3 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 43284731 118944897 Rat 1300167 Hrtrt2 Heart rate QTL 2 4.35 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 11481312 75088344 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 2313078 Bss54 Bone structure and strength QTL 54 3.5 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 2313077 Bss69 Bone structure and strength QTL 69 3.5 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 11481312 82174945 Rat 1331778 Rf28 Renal function QTL 28 4.66 urine potassium amount (VT:0010539) urine potassium excretion rate (CMO:0000761) 1 45803140 78430678 Rat 1578756 Iddm22 Insulin dependent diabetes mellitus QTL 22 2.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 11835181 56835181 Rat 631508 Sald1 Serum aldosterone level QTL 1 3.7 blood aldosterone amount (VT:0005346) serum aldosterone level (CMO:0000487) 1 9856001 54856001 Rat 1331785 Rf27 Renal function QTL 27 4.643 urine sodium amount (VT:0006274) urine sodium level (CMO:0000129) 1 28879780 78430678 Rat 1300172 Bp172 Blood pressure QTL 172 3.56 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 32737273 90665040 Rat 724520 Bp145 Blood pressure QTL 145 2.1 0.0024 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 20784828 65784828 Rat 2313094 Bss58 Bone structure and strength QTL 58 3.7 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 43284731 118944897 Rat 2313092 Bmd72 Bone mineral density QTL 72 2.5 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 11481312 82174945 Rat 2313099 Bss56 Bone structure and strength QTL 56 2.4 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 1 43284731 118944897 Rat 2313098 Bmd70 Bone mineral density QTL 70 3.6 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 43284731 118944897 Rat 2313097 Bss70 Bone structure and strength QTL 70 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 9589820 Insglur3 Insulin/glucose ratio QTL 3 10.75 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 1 34836858 79836858 Rat 738020 Pia8 Pristane induced arthritis QTL 8 4.7 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 1 65833076 Rat 1354599 Bw29 Body weight QTL 29 3.46 0.001 body mass (VT:0001259) body weight (CMO:0000012) 1 33449848 78449848 Rat 2302038 Pia31 Pristane induced arthritis QTL 31 5.5 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111) 1 10992065 55992065 Rat 8552948 Pigfal11 Plasma insulin-like growth factor 1 level QTL 11 4.7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 634353 Rends2 Renal damage susceptibility QTL 2 0.05 kidney blood vessel morphology trait (VT:0000530) organ lesion measurement (CMO:0000677) 1 19333571 56983283 Rat 2313051 Bss57 Bone structure and strength QTL 57 3.7 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 43284731 118944897 Rat
BB276039
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 47,911,325 - 47,911,450 (+) MAPPER mRatBN7.2 Rnor_6.0 1 48,108,044 - 48,108,168 NCBI Rnor6.0 Rnor_5.0 1 51,644,770 - 51,644,894 UniSTS Rnor5.0 RGSC_v3.4 1 42,185,576 - 42,185,700 UniSTS RGSC3.4 Celera 1 43,710,948 - 43,711,072 UniSTS Cytogenetic Map 1 q11-q12 UniSTS
BF386436
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 47,891,940 - 47,892,149 (+) MAPPER mRatBN7.2 Rnor_6.0 1 48,088,663 - 48,088,871 NCBI Rnor6.0 Rnor_5.0 1 51,663,532 - 51,663,740 UniSTS Rnor5.0 RGSC_v3.4 1 42,166,411 - 42,166,619 UniSTS RGSC3.4 Celera 1 43,691,652 - 43,691,860 UniSTS RH 3.4 Map 1 539.4 UniSTS Cytogenetic Map 1 q11-q12 UniSTS
RH94551
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 47,911,027 - 47,911,127 (+) MAPPER mRatBN7.2 Rnor_6.0 1 48,107,746 - 48,107,845 NCBI Rnor6.0 Rnor_5.0 1 51,645,093 - 51,645,192 UniSTS Rnor5.0 RGSC_v3.4 1 42,185,278 - 42,185,377 UniSTS RGSC3.4 Celera 1 43,710,650 - 43,710,749 UniSTS RH 3.4 Map 1 544.2 UniSTS Cytogenetic Map 1 q11-q12 UniSTS
BF414744
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 47,911,011 - 47,911,185 (+) MAPPER mRatBN7.2 Rnor_6.0 1 48,107,730 - 48,107,903 NCBI Rnor6.0 Rnor_5.0 1 51,645,035 - 51,645,208 UniSTS Rnor5.0 RGSC_v3.4 1 42,185,262 - 42,185,435 UniSTS RGSC3.4 Celera 1 43,710,634 - 43,710,807 UniSTS RH 3.4 Map 1 563.3 UniSTS Cytogenetic Map 1 q11-q12 UniSTS
This gene Mas1 is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
27
85
68
67
36
25
36
6
157
75
65
29
49
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000020100 ⟹ ENSRNOP00000020100
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 47,880,309 - 47,911,498 (+) Ensembl Rnor_6.0 Ensembl 1 48,077,033 - 48,108,216 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000104217 ⟹ ENSRNOP00000097396
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 47,900,582 - 47,911,709 (+) Ensembl
RefSeq Acc Id:
NM_012757 ⟹ NP_036889
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,428,090 - 50,459,277 (+) NCBI mRatBN7.2 1 47,880,309 - 47,911,500 (+) NCBI Rnor_6.0 1 48,077,033 - 48,108,218 (+) NCBI Rnor_5.0 1 51,644,462 - 51,675,365 (-) NCBI RGSC_v3.4 1 42,154,786 - 42,185,750 (+) RGD Celera 1 43,680,754 - 43,711,122 (+) RGD
Sequence:
GGAGGAAGGCTGCCTGCATACTGGGAAGACCAGCCCACAGTTACCAGTTCTTCCGGCTTTCTGGATTCTCAAAGTCAGAAGGGGAACCCTGGGCTTTGGTGAAGCACTCGAGGCTCTCTTCCTGTGAT
hide sequence
RefSeq Acc Id:
XM_006227860 ⟹ XP_006227922
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,446,962 - 50,459,537 (+) NCBI mRatBN7.2 1 47,899,794 - 47,911,500 (+) NCBI Rnor_6.0 1 48,093,445 - 48,108,021 (+) NCBI Rnor_5.0 1 51,644,462 - 51,675,365 (-) NCBI
Sequence:
AGAGACATCCTTCGGTGTTTGAAATCACTGTGACCCTTTTAACTGGGATGGGATGGACCATGCTTCCTGATGTCTTGTCAATCAATCTAACCATTCCTCCTGCTTCAGACTGCCTAGCCCTGTAGTCA
hide sequence
RefSeq Acc Id:
XM_039101408 ⟹ XP_038957336
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,446,962 - 50,459,537 (+) NCBI mRatBN7.2 1 47,899,795 - 47,911,500 (+) NCBI
RefSeq Acc Id:
XM_039101409 ⟹ XP_038957337
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,428,064 - 50,459,537 (+) NCBI mRatBN7.2 1 47,879,956 - 47,911,500 (+) NCBI
RefSeq Acc Id:
XM_039101416 ⟹ XP_038957344
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,446,962 - 50,459,537 (+) NCBI mRatBN7.2 1 47,899,795 - 47,911,500 (+) NCBI
RefSeq Acc Id:
XM_063281307 ⟹ XP_063137377
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,445,359 - 50,459,537 (+) NCBI
RefSeq Acc Id:
XM_063281312 ⟹ XP_063137382
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,452,991 - 50,459,537 (+) NCBI
RefSeq Acc Id:
XM_063281318 ⟹ XP_063137388
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,446,962 - 50,459,537 (+) NCBI
RefSeq Acc Id:
XM_063281319 ⟹ XP_063137389
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,428,080 - 50,459,537 (+) NCBI
RefSeq Acc Id:
XM_063281329 ⟹ XP_063137399
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 50,428,064 - 50,459,537 (+) NCBI
RefSeq Acc Id:
NP_036889 ⟸ NM_012757
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
- Sequence:
MDQSNMTSFAEEKAMNTSSRNASLGTSHPPIPIVHWVIMSISPLGFVENGILLWFLCFRMRRNPFTVYITHLSIADISLLFCIFILSIDYALDYELSSGHYYTIVTLSVTFLFGYNTGLYLLTAISVE
hide sequence
RefSeq Acc Id:
XP_006227922 ⟸ XM_006227860
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
- Sequence:
MDQSNMTSFAEEKAMNTSSRNASLGTSHPPIPIVHWVIMSISPLGFVENGILLWFLCFRMRRNPFTVYITHLSIADISLLFCIFILSIDYALDYELSSGHYYTIVTLSVTFLFGYNTGLYLLTAISVE
hide sequence
Ensembl Acc Id:
ENSRNOP00000020100 ⟸ ENSRNOT00000020100
RefSeq Acc Id:
XP_038957337 ⟸ XM_039101409
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038957336 ⟸ XM_039101408
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038957344 ⟸ XM_039101416
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000097396 ⟸ ENSRNOT00000104217
RefSeq Acc Id:
XP_063137399 ⟸ XM_063281329
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063137389 ⟸ XM_063281319
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063137377 ⟸ XM_063281307
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063137388 ⟸ XM_063281318
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063137382 ⟸ XM_063281312
- Peptide Label:
isoform X1
- UniProtKB:
P12526 (UniProtKB/Swiss-Prot), W8W3M4 (UniProtKB/TrEMBL)
RGD ID: 13689618 Promoter ID: EPDNEW_R141 Type: single initiation site Name: Mas1_1 Description: MAS1 proto-oncogene, G protein-coupled receptor SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 48,076,990 - 48,077,050 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2002-06-10
Mas1
MAS1 oncogene
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
expressed in hippocampus and cerebral cortex
728946
