Symbol:
Gapdh (Ensembl: Gapdhl3)
Name:
glyceraldehyde-3-phosphate dehydrogenase (Ensembl:glyceraldehyde-3-phosphate dehydrogenase like 3)
RGD ID:
2661
Description:
Enables several functions, including glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity; identical protein binding activity; and peptidyl-cysteine S-nitrosylase activity. Involved in several processes, including gluconeogenesis; intracellular signaling cassette; and negative regulation of vascular associated smooth muscle cell apoptotic process. Located in cytosol; microtubule cytoskeleton; and nucleus. Is active in glutamatergic synapse and postsynaptic density, intracellular component. Used to study Alzheimer's disease and middle cerebral artery infarction. Biomarker of several diseases, including brain glioma; diabetic retinopathy; obesity; oral squamous cell carcinoma; and rheumatic heart disease. Human ortholog(s) of this gene implicated in Alzheimer's disease. Orthologous to human GAPDH (glyceraldehyde-3-phosphate dehydrogenase); PARTICIPATES IN gluconeogenesis pathway; electron transport chain pathway; Fanconi syndrome pathway; INTERACTS WITH (-)-selegiline; 1,3-dinitrobenzene; 17alpha-ethynylestradiol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
38 kDa BFA-dependent ADP-ribosylation substrate; BARS-38; Gapd; peptidyl-cysteine S-nitrosylase GAPDH
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Related Pseudogenes:
Gapdh-ps1
Gapdh-ps118
Gapdh-ps119
Gapdh-ps2
Gapdh-ps36
Gapdh-ps49
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 159,648,592 - 159,653,436 (-) NCBI GRCr8 mRatBN7.2 4 157,962,312 - 157,967,158 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 157,962,343 - 157,966,235 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 4 157,676,336 - 157,680,322 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_5.0 4 224,693,580 - 224,697,455 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 161,282,215 - 161,286,090 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 146,699,388 - 146,703,263 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gapdh Rat (-)-selegiline multiple interactions ISO GAPDH (Homo sapiens) 6480464 Selegiline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of GAPDH mRNA] CTD PMID:14724376 Gapdh Rat (-)-selegiline multiple interactions EXP 6480464 Selegiline inhibits the reaction [Paraquat affects the localization of GAPDH protein] CTD PMID:20478973 Gapdh Rat (-)-selegiline multiple interactions ISO Gapdh (Mus musculus) 6480464 Selegiline inhibits the reaction [Hydroxyurea affects the localization of GAPDH protein] CTD PMID:23696560 Gapdh Rat (1->4)-beta-D-glucan multiple interactions ISO Gapdh (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of GAPDH mRNA CTD PMID:36331819 Gapdh Rat (S)-nicotine multiple interactions ISO Gapdh (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Gapdh Rat 1,10-phenanthroline increases expression ISO GAPDH (Homo sapiens) 6480464 1 and 10-phenanthroline results in increased expression of GAPDH mRNA CTD PMID:19502547 Gapdh Rat 1,2-dimethylhydrazine multiple interactions ISO Gapdh (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of GAPDH mRNA CTD PMID:22206623 Gapdh Rat 1,2-naphthoquinone decreases activity ISO GAPDH (Homo sapiens) 6480464 1 and 2-naphthoquinone results in decreased activity of GAPDH protein CTD PMID:21827172 Gapdh Rat 1,2-naphthoquinone affects binding ISO GAPDH (Homo sapiens) 6480464 1 and 2-naphthoquinone binds to GAPDH protein CTD PMID:21827172 Gapdh Rat 1,2-naphthoquinone multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Buthionine Sulfoximine results in decreased abundance of Glutathione] promotes the reaction [1 more ... CTD PMID:21827172 Gapdh Rat 1,3-dinitrobenzene increases oxidation EXP 6480464 3-dinitrobenzene results in increased oxidation of GAPDH protein CTD PMID:25716674 Gapdh Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine decreases expression ISO Gapdh (Mus musculus) 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Gapdh Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine multiple interactions ISO Gapdh (Mus musculus) 6480464 [Caffeine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Gapdh Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of GAPDH mRNA CTD PMID:10822019 and PMID:17557909 Gapdh Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of GAPDH mRNA CTD PMID:32145629 Gapdh Rat 17beta-estradiol decreases expression ISO Gapdh (Mus musculus) 6480464 Estradiol results in decreased expression of GAPDH mRNA CTD PMID:39298647 Gapdh Rat 17beta-hydroxy-5alpha-androstan-3-one decreases activity EXP 6480464 Dihydrotestosterone results in decreased activity of GAPDH protein CTD PMID:10650946 Gapdh Rat 17beta-hydroxy-5alpha-androstan-3-one multiple interactions EXP 6480464 nilutamide inhibits the reaction [Dihydrotestosterone results in decreased activity of GAPDH protein] CTD PMID:10650946 Gapdh Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Gapdh (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of GAPDH mRNA and Tetrachlorodibenzodioxin results in increased expression of GAPDH protein CTD PMID:12361703 and PMID:33387578 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of GAPDH mRNA CTD PMID:34747641 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of GAPDH mRNA CTD PMID:32109520 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Gapdh (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of GAPDH mRNA CTD PMID:15667827 and PMID:24680724 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine increases activity ISO Gapdh (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased activity of GAPDH protein CTD PMID:19850099 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Gapdh (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of GAPDH mRNA and Tetrachlorodibenzodioxin results in increased expression of GAPDH protein CTD PMID:19770486 more ... Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Gapdh (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of GAPDH mRNA CTD PMID:21570461 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Gapdh (Mus musculus) 6480464 AHR protein affects the reaction [Tetrachlorodibenzodioxin results in increased expression of GAPDH mRNA] CTD PMID:19850099 Gapdh Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO GAPDH (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of GAPDH mRNA CTD PMID:23152189 Gapdh Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Gapdh Rat 2,3-dimethoxynaphthalene-1,4-dione increases expression ISO GAPDH (Homo sapiens) 6480464 2 more ... CTD PMID:37788135 Gapdh Rat 2,4,6-trinitrotoluene affects expression EXP 6480464 Trinitrotoluene affects the expression of GAPDH mRNA CTD PMID:21346803 Gapdh Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether decreases expression ISO Gapdh (Mus musculus) 6480464 2 more ... CTD PMID:18550172 Gapdh Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Gapdh (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Gapdh Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:19954255 Gapdh Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression EXP 6480464 2 more ... CTD PMID:19954255 Gapdh Rat 2,5-hexanedione decreases expression EXP 6480464 2 and 5-hexanedione results in decreased expression of GAPDH protein CTD PMID:15928459 Gapdh Rat 2,6-dimethoxyphenol multiple interactions ISO GAPDH (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Gapdh Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of GAPDH mRNA CTD PMID:21346803 Gapdh Rat 2-bromohexadecanoic acid increases activity EXP 6480464 2-bromopalmitate results in increased activity of GAPDH protein CTD PMID:10650946 Gapdh Rat 2-methoxyethanol increases expression EXP 6480464 methyl cellosolve results in increased expression of GAPDH mRNA CTD PMID:19643169 Gapdh Rat 2-methoxyethanol decreases expression EXP 6480464 methyl cellosolve results in decreased expression of GAPDH protein CTD PMID:15928459 Gapdh Rat 3,3',4,4',5-pentachlorobiphenyl affects expression ISO Gapdh (Mus musculus) 6480464 3 more ... CTD PMID:37080397 Gapdh Rat 3,3',5,5'-tetrabromobisphenol A affects expression ISO GAPDH (Homo sapiens) 6480464 tetrabromobisphenol A affects the expression of GAPDH protein CTD PMID:30098271 Gapdh Rat 3,7-dihydropurine-6-thione affects localization ISO GAPDH (Homo sapiens) 6480464 Mercaptopurine affects the localization of GAPDH protein CTD PMID:19628630 Gapdh Rat 3-bromopyruvic acid decreases expression ISO Gapdh (Mus musculus) 6480464 bromopyruvate results in decreased expression of GAPDH mRNA CTD PMID:28433571 Gapdh Rat 3-chloropropane-1,2-diol decreases activity EXP 6480464 alpha-Chlorohydrin results in decreased activity of GAPDH protein CTD PMID:16322075 Gapdh Rat 3-chloropropane-1,2-diol decreases expression EXP 6480464 alpha-Chlorohydrin analog results in decreased expression of GAPDH protein and alpha-Chlorohydrin results in decreased expression of GAPDH protein CTD PMID:26597043 Gapdh Rat 3-chloropropane-1,2-diol multiple interactions EXP 6480464 [alpha-Chlorohydrin results in decreased activity of GAPDH protein] which results in decreased reduction of Arsenates CTD PMID:16322075 Gapdh Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO GAPDH (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of GAPDH mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GAPDH mRNA CTD PMID:28628672 Gapdh Rat 3-nitropropanoic acid multiple interactions EXP 6480464 Ginkgo biloba extract inhibits the reaction [3-nitropropionic acid results in increased expression of GAPDH mRNA] CTD PMID:21827809 Gapdh Rat 3-nitropropanoic acid increases expression EXP 6480464 3-nitropropionic acid results in increased expression of GAPDH mRNA CTD PMID:21827809 Gapdh Rat 3-phosphoglyceric acid multiple interactions EXP 6480464 [GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased chemical synthesis of sodium arsenite more ... CTD PMID:15788719 Gapdh Rat 3H-1,2-dithiole-3-thione increases expression EXP 6480464 1 and 2-dithiol-3-thione results in increased expression of GAPDH mRNA CTD PMID:19162173 Gapdh Rat 4,4'-sulfonyldiphenol affects expression ISO Gapdh (Mus musculus) 6480464 bisphenol S affects the expression of GAPDH mRNA CTD PMID:39298647 Gapdh Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of GAPDH mRNA CTD PMID:36041667 Gapdh Rat 4,4'-sulfonyldiphenol increases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol S results in increased expression of GAPDH protein CTD PMID:34186270 Gapdh Rat 4-amino-2,6-dinitrotoluene affects expression EXP 6480464 4-amino-2 and 6-dinitrotoluene affects the expression of GAPDH mRNA CTD PMID:21346803 Gapdh Rat 4-hydroxynon-2-enal multiple interactions ISO Gapdh (Mus musculus) 6480464 [Hydroxyurea promotes the reaction [4-hydroxy-2-nonenal binds to GAPDH protein]] which results in decreased activity of GAPDH protein more ... CTD PMID:20889679 and PMID:23696560 Gapdh Rat 4-tert-Octylphenol increases expression EXP 6480464 4-tert-octylphenol results in increased expression of GAPDH mRNA CTD PMID:10822019 Gapdh Rat 5-aza-2'-deoxycytidine increases expression ISO Gapdh (Mus musculus) 6480464 Decitabine results in increased expression of GAPDH mRNA CTD PMID:27915011 Gapdh Rat 5-aza-2'-deoxycytidine decreases expression ISO GAPDH (Homo sapiens) 6480464 Decitabine results in decreased expression of GAPDH protein CTD PMID:19294695 Gapdh Rat 5-aza-2'-deoxycytidine increases expression ISO GAPDH (Homo sapiens) 6480464 Decitabine results in increased expression of GAPDH mRNA CTD PMID:17908484 Gapdh Rat 5-fluorouracil affects splicing ISO GAPDH (Homo sapiens) 6480464 Fluorouracil affects the splicing of GAPDH mRNA CTD PMID:17169984 Gapdh Rat 5-fluorouracil decreases expression ISO Gapdh (Mus musculus) 6480464 Fluorouracil results in decreased expression of GAPDH protein CTD PMID:21296659 Gapdh Rat 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole affects expression EXP 6480464 Omeprazole affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat 6-propyl-2-thiouracil affects expression EXP 6480464 Propylthiouracil affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat 7,12-dimethyltetraphene decreases expression ISO GAPDH (Homo sapiens) 6480464 9 more ... CTD PMID:19502547 Gapdh Rat 7,12-dimethyltetraphene multiple interactions EXP 6480464 [9 more ... CTD PMID:22248470 Gapdh Rat 7,12-dimethyltetraphene increases expression EXP 6480464 9 more ... CTD PMID:22248470 Gapdh Rat 7-nitroindazole multiple interactions EXP 6480464 [7-nitroindazole results in decreased chemical synthesis of Nitric Oxide] inhibits the reaction [Paraquat affects the localization of GAPDH protein] CTD PMID:20478973 Gapdh Rat 9-cis-retinoic acid decreases expression ISO GAPDH (Homo sapiens) 6480464 Alitretinoin results in decreased expression of GAPDH protein CTD PMID:28886987 Gapdh Rat acetaldehyde multiple interactions ISO GAPDH (Homo sapiens) 6480464 [MPO protein co-treated with XDH protein co-treated with Acetaldehyde co-treated with Serotonin] affects the metabolism of and binds to GAPDH protein CTD PMID:23009681 Gapdh Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of GAPDH mRNA CTD PMID:31881176 Gapdh Rat acetic acid increases expression ISO Gapdh (Mus musculus) 6480464 Acetic Acid results in increased expression of GAPDH protein CTD PMID:21296659 Gapdh Rat acrolein affects binding EXP 6480464 Acrolein binds to GAPDH protein CTD PMID:17023561 Gapdh Rat acrolein multiple interactions ISO GAPDH (Homo sapiens) 6480464 Acrolein binds to and results in decreased activity of GAPDH protein CTD PMID:22084934 Gapdh Rat acrylamide multiple interactions ISO GAPDH (Homo sapiens) 6480464 Acrylamide binds to and results in decreased activity of GAPDH protein CTD PMID:22084934 Gapdh Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of GAPDH mRNA CTD PMID:28959563 Gapdh Rat actinomycin D increases expression ISO GAPDH (Homo sapiens) 6480464 Dactinomycin results in increased expression of GAPDH mRNA CTD PMID:16001973 Gapdh Rat actinomycin D multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of GAPDH protein CTD PMID:38460933 Gapdh Rat ADP multiple interactions ISO GAPDH (Homo sapiens) 6480464 Adenosine Diphosphate inhibits the reaction [[GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog] CTD PMID:15788719 Gapdh Rat aflatoxin B1 decreases expression ISO Gapdh (Mus musculus) 6480464 Aflatoxin B1 results in decreased expression of GAPDH mRNA CTD PMID:19770486 Gapdh Rat aldehydo-D-glucose multiple interactions EXP 6480464 [chloroacetaldehyde results in decreased activity of GAPDH protein] which results in decreased chemical synthesis of Glucose more ... CTD PMID:11050244 more ... Gapdh Rat aldehydo-D-glucose increases ADP-ribosylation ISO Gapdh (Mus musculus) 6480464 Glucose results in increased ADP-ribosylation of GAPDH protein CTD PMID:14523042 Gapdh Rat aldehydo-D-glucose multiple interactions ISO Gapdh (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:14523042 and PMID:37567420 Gapdh Rat aldehydo-D-glucose increases expression ISO GAPDH (Homo sapiens) 6480464 Glucose results in increased expression of GAPDH mRNA CTD PMID:7826318 Gapdh Rat aldehydo-D-glucose multiple interactions ISO GAPDH (Homo sapiens) 6480464 SOD2 protein inhibits the reaction [[Glucose results in increased chemical synthesis of Superoxides] which results in decreased activity of GAPDH protein] and SOD2 protein inhibits the reaction [Glucose results in decreased activity of and results in increased ADP-ribosylation of GAPDH protein] CTD PMID:11050244 and PMID:14523042 Gapdh Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of GAPDH mRNA CTD PMID:24977338 Gapdh Rat all-trans-retinoic acid multiple interactions ISO GAPDH (Homo sapiens) 6480464 tributyltin promotes the reaction [Tretinoin results in decreased expression of GAPDH protein] and triphenyltin chloride promotes the reaction [Tretinoin results in decreased expression of GAPDH protein] CTD PMID:30806631 Gapdh Rat all-trans-retinoic acid decreases expression ISO GAPDH (Homo sapiens) 6480464 Tretinoin results in decreased expression of GAPDH protein CTD PMID:28886987 and PMID:30806631 Gapdh Rat aloxistatin multiple interactions ISO GAPDH (Homo sapiens) 6480464 aloxistatin inhibits the reaction [syringic acid analog results in increased secretion of GAPDH protein] CTD PMID:34523043 Gapdh Rat alpha-amanitin decreases expression ISO Gapdh (Mus musculus) 6480464 Alpha-Amanitin results in decreased expression of GAPDH mRNA CTD PMID:26385100 Gapdh Rat alpha-amanitin multiple interactions ISO Gapdh (Mus musculus) 6480464 Polymyxin B inhibits the reaction [Alpha-Amanitin results in decreased expression of GAPDH mRNA] CTD PMID:26385100 Gapdh Rat alpha-hexachlorocyclohexane affects expression EXP 6480464 alpha-hexachlorocyclohexane affects the expression of GAPDH mRNA CTD PMID:16940010 Gapdh Rat alpha-hexachlorocyclohexane decreases expression EXP 6480464 alpha-hexachlorocyclohexane results in decreased expression of GAPDH mRNA CTD PMID:16940010 Gapdh Rat alpha-hexachlorocyclohexane increases expression EXP 6480464 alpha-hexachlorocyclohexane results in increased expression of GAPDH mRNA CTD PMID:16940010 Gapdh Rat alpha-Zearalanol decreases expression EXP 6480464 Zeranol results in decreased expression of GAPDH mRNA CTD PMID:35163327 Gapdh Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of GAPDH mRNA CTD PMID:35163327 Gapdh Rat amiodarone affects expression EXP 6480464 Amiodarone affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat ammonium chloride affects metabolic processing EXP 6480464 Ammonium Chloride affects the metabolism of GAPDH protein CTD PMID:11923223 Gapdh Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of GAPDH mRNA CTD PMID:16483693 Gapdh Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of GAPDH mRNA CTD PMID:30779732 Gapdh Rat aristolochic acid A decreases expression ISO GAPDH (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of GAPDH mRNA CTD PMID:33212167 Gapdh Rat Aroclor 1254 increases expression ISO GAPDH (Homo sapiens) 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of GAPDH mRNA CTD PMID:17851650 Gapdh Rat Aroclor 1254 decreases expression ISO Gapdh (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of GAPDH mRNA CTD PMID:23650126 Gapdh Rat Aroclor 1254 increases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of GAPDH mRNA and Chlorodiphenyl (54% Chlorine) results in increased expression of GAPDH protein CTD PMID:18178546 and PMID:21791222 Gapdh Rat arsane multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat arsenic atom multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat arsenite(3-) multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [arsenite results in decreased expression of GAPDH protein] and Glutathione inhibits the reaction [arsenite results in decreased expression of GAPDH protein] CTD PMID:15175009 Gapdh Rat arsenite(3-) decreases expression EXP 6480464 arsenite results in decreased expression of GAPDH protein CTD PMID:15175009 Gapdh Rat arsenous acid multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of GAPDH protein more ... CTD PMID:26598702 and PMID:38160894 Gapdh Rat arsenous acid increases expression ISO Gapdh (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of GAPDH mRNA CTD PMID:35676786 Gapdh Rat arsenous acid decreases expression ISO GAPDH (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of GAPDH mRNA and Arsenic Trioxide results in decreased expression of GAPDH protein CTD PMID:38160894 Gapdh Rat arsenous acid decreases activity ISO Gapdh (Mus musculus) 6480464 Arsenic Trioxide results in decreased activity of GAPDH protein CTD PMID:15916724 Gapdh Rat ATP multiple interactions ISO GAPDH (Homo sapiens) 6480464 Adenosine Triphosphate inhibits the reaction [[GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog] CTD PMID:15788719 Gapdh Rat benzbromarone affects expression EXP 6480464 Benzbromarone affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat benzo[a]pyrene increases expression ISO GAPDH (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of GAPDH protein CTD PMID:17292933 Gapdh Rat benzo[a]pyrene increases expression ISO Gapdh (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of GAPDH mRNA CTD PMID:19770486 Gapdh Rat beta-D-fructofuranose 1,6-bisphosphate multiple interactions EXP 6480464 [GAPDH protein co-treated with fructose-1 more ... CTD PMID:15788719 Gapdh Rat beta-lapachone increases expression ISO GAPDH (Homo sapiens) 6480464 beta-lapachone results in increased expression of GAPDH mRNA CTD PMID:38218311 Gapdh Rat beta-naphthoflavone increases expression ISO Gapdh (Mus musculus) 6480464 beta-Naphthoflavone results in increased expression of GAPDH mRNA CTD PMID:19850099 Gapdh Rat bis(2-chloroethyl) sulfide affects expression EXP 6480464 Mustard Gas affects the expression of GAPDH mRNA CTD PMID:15651846 Gapdh Rat bis(2-chloroethyl) sulfide increases expression ISO GAPDH (Homo sapiens) 6480464 Mustard Gas results in increased expression of GAPDH protein CTD PMID:23827652 Gapdh Rat bis(2-chloroethyl) sulfide affects localization ISO GAPDH (Homo sapiens) 6480464 Mustard Gas affects the localization of GAPDH protein CTD PMID:23827652 Gapdh Rat bis(2-ethylhexyl) phthalate increases methylation EXP 6480464 Diethylhexyl Phthalate results in increased methylation of GAPDH gene CTD PMID:33923623 Gapdh Rat bis(2-ethylhexyl) phthalate decreases expression ISO Gapdh (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of GAPDH mRNA CTD PMID:33754040 Gapdh Rat bisphenol A increases expression ISO Gapdh (Mus musculus) 6480464 bisphenol A results in increased expression of GAPDH protein CTD PMID:25772901 Gapdh Rat bisphenol A decreases expression ISO Gapdh (Mus musculus) 6480464 bisphenol A results in decreased expression of GAPDH mRNA and bisphenol A results in decreased expression of GAPDH protein CTD PMID:35598803 and PMID:35999755 Gapdh Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of GAPDH mRNA CTD PMID:36041667 Gapdh Rat bisphenol A increases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol A results in increased expression of GAPDH protein CTD PMID:33376534 and PMID:33670352 Gapdh Rat bisphenol A decreases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol A results in decreased expression of GAPDH protein CTD PMID:33024228 and PMID:34186270 Gapdh Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of GAPDH mRNA and bisphenol A affects the expression of GAPDH protein CTD PMID:32145629 and PMID:34947998 Gapdh Rat bisphenol A affects splicing ISO Gapdh (Mus musculus) 6480464 bisphenol A affects the splicing of GAPDH mRNA CTD PMID:37894381 Gapdh Rat bisphenol A affects expression ISO GAPDH (Homo sapiens) 6480464 bisphenol A affects the expression of GAPDH mRNA CTD PMID:30903817 Gapdh Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of GAPDH mRNA CTD PMID:30816183 and PMID:32528016 Gapdh Rat bisphenol A multiple interactions ISO GAPDH (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of GAPDH mRNA CTD PMID:28628672 Gapdh Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of GAPDH mRNA CTD PMID:25181051 and PMID:32145629 Gapdh Rat bisphenol AF increases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol AF results in increased expression of GAPDH protein CTD PMID:34186270 Gapdh Rat Bisphenol B increases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol B results in increased expression of GAPDH protein CTD PMID:34186270 Gapdh Rat bisphenol F multiple interactions ISO GAPDH (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GAPDH mRNA CTD PMID:28628672 Gapdh Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of GAPDH mRNA CTD PMID:36041667 Gapdh Rat bisphenol F increases expression ISO GAPDH (Homo sapiens) 6480464 bisphenol F results in increased expression of GAPDH protein CTD PMID:34186270 Gapdh Rat boric acid decreases expression ISO Gapdh (Mus musculus) 6480464 boric acid results in decreased expression of GAPDH protein CTD PMID:28285642 Gapdh Rat bromochloroacetic acid increases expression ISO Gapdh (Mus musculus) 6480464 bromochloroacetic acid results in increased expression of GAPDH protein CTD PMID:21296659 Gapdh Rat buten-2-one multiple interactions ISO GAPDH (Homo sapiens) 6480464 3-buten-2-one binds to and results in decreased activity of GAPDH protein CTD PMID:22084934 Gapdh Rat cadmium atom increases expression EXP 6480464 Cadmium results in increased expression of GAPDH mRNA CTD PMID:17123754 Gapdh Rat cadmium atom multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of GAPDH mRNA more ... CTD PMID:32917723 and PMID:38945390 Gapdh Rat cadmium atom multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of GAPDH protein CTD PMID:33040242 Gapdh Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of GAPDH mRNA CTD PMID:17123754 Gapdh Rat cadmium dichloride decreases activity ISO GAPDH (Homo sapiens) 6480464 Cadmium Chloride results in decreased activity of GAPDH protein CTD PMID:37336463 Gapdh Rat cadmium dichloride multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of GAPDH mRNA CTD PMID:32917723 Gapdh Rat cadmium dichloride decreases activity ISO Gapdh (Mus musculus) 6480464 Cadmium Chloride results in decreased activity of GAPDH protein CTD PMID:29653258 Gapdh Rat cadmium dichloride increases expression ISO GAPDH (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of GAPDH protein CTD PMID:24527689 Gapdh Rat cadmium dichloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of GAPDH protein and vanillin inhibits the reaction [Cadmium Chloride results in decreased activity of GAPDH protein] CTD PMID:33040242 and PMID:37336463 Gapdh Rat caffeine multiple interactions ISO Gapdh (Mus musculus) 6480464 [Caffeine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Gapdh Rat caffeine decreases phosphorylation ISO GAPDH (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of GAPDH protein CTD PMID:35688186 Gapdh Rat capsaicin multiple interactions EXP 6480464 Capsaicin inhibits the reaction [Dietary Fats results in increased expression of GAPDH protein] CTD PMID:20359164 Gapdh Rat capsaicin increases expression ISO GAPDH (Homo sapiens) 6480464 Capsaicin results in increased expression of GAPDH protein CTD PMID:18991268 Gapdh Rat captan increases expression ISO Gapdh (Mus musculus) 6480464 Captan results in increased expression of GAPDH mRNA CTD PMID:31558096 Gapdh Rat carbon nanotube affects expression ISO GAPDH (Homo sapiens) 6480464 Nanotubes and Carbon affects the expression of GAPDH protein CTD PMID:22001959 Gapdh Rat carbon nanotube increases expression ISO Gapdh (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Gapdh Rat carbon nanotube affects expression ISO Gapdh (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25620056 Gapdh Rat carbon nanotube increases expression ISO GAPDH (Homo sapiens) 6480464 Nanotubes and Carbon results in increased expression of GAPDH protein CTD PMID:22157353 Gapdh Rat celastrol multiple interactions ISO Gapdh (Mus musculus) 6480464 celastrol inhibits the reaction [Dietary Fats results in decreased expression of GAPDH mRNA] CTD PMID:35679966 Gapdh Rat cerium trichloride decreases expression ISO GAPDH (Homo sapiens) 6480464 cerous chloride results in decreased expression of GAPDH mRNA CTD PMID:28954213 Gapdh Rat cerium trichloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 [cerous chloride co-treated with lanthanum chloride] results in decreased expression of GAPDH mRNA CTD PMID:28954213 Gapdh Rat chloroacetaldehyde decreases activity EXP 6480464 chloroacetaldehyde results in decreased activity of GAPDH protein CTD PMID:19733226 Gapdh Rat chloroacetaldehyde multiple interactions EXP 6480464 [chloroacetaldehyde results in decreased activity of GAPDH protein] which results in decreased chemical synthesis of Glucose CTD PMID:19733226 Gapdh Rat chloroacetic acid decreases activity EXP 6480464 chloroacetic acid results in decreased activity of GAPDH protein CTD PMID:15720133 Gapdh Rat chloropicrin increases expression ISO GAPDH (Homo sapiens) 6480464 chloropicrin results in increased expression of GAPDH mRNA CTD PMID:26352163 Gapdh Rat chlorpyrifos increases expression ISO Gapdh (Mus musculus) 6480464 Chlorpyrifos results in increased expression of GAPDH mRNA CTD PMID:37019170 Gapdh Rat cisplatin increases expression ISO GAPDH (Homo sapiens) 6480464 Cisplatin results in increased expression of GAPDH protein CTD PMID:21924258 Gapdh Rat cisplatin decreases expression ISO GAPDH (Homo sapiens) 6480464 Cisplatin results in decreased expression of GAPDH mRNA CTD PMID:29690507 Gapdh Rat cisplatin multiple interactions ISO GAPDH (Homo sapiens) 6480464 [eprenetapopt co-treated with Cisplatin] inhibits the reaction [Oxygen deficiency results in increased expression of GAPDH mRNA] more ... CTD PMID:29690507 Gapdh Rat clofibrate affects expression EXP 6480464 Clofibrate affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat clozapine increases expression EXP 6480464 Clozapine results in increased expression of GAPDH mRNA CTD PMID:15860345 Gapdh Rat clozapine increases expression ISO GAPDH (Homo sapiens) 6480464 Clozapine results in increased expression of GAPDH protein CTD PMID:34122009 Gapdh Rat cobalt dichloride increases expression ISO Gapdh (Mus musculus) 6480464 cobaltous chloride results in increased expression of GAPDH mRNA CTD PMID:10646848 Gapdh Rat cobalt dichloride increases expression ISO GAPDH (Homo sapiens) 6480464 cobaltous chloride results in increased expression of GAPDH mRNA CTD PMID:10646848 more ... Gapdh Rat cobalt dichloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 tetraethylenepentamine inhibits the reaction [cobaltous chloride results in increased expression of GAPDH mRNA] CTD PMID:25100165 Gapdh Rat cobalt dichloride multiple interactions ISO Gapdh (Mus musculus) 6480464 HIF1A protein affects the reaction [cobaltous chloride results in increased expression of GAPDH mRNA] CTD PMID:10646848 Gapdh Rat cobalt(2+) sulfate increases expression ISO GAPDH (Homo sapiens) 6480464 cobalt sulfate results in increased expression of GAPDH mRNA CTD PMID:19502547 Gapdh Rat copper atom affects binding ISO GAPDH (Homo sapiens) 6480464 GAPDH protein binds to Copper CTD PMID:14534351 and PMID:15359738 Gapdh Rat copper(0) affects binding ISO GAPDH (Homo sapiens) 6480464 GAPDH protein binds to Copper CTD PMID:14534351 and PMID:15359738 Gapdh Rat copper(II) sulfate increases expression ISO Gapdh (Mus musculus) 6480464 Copper Sulfate results in increased expression of GAPDH mRNA CTD PMID:25216733 Gapdh Rat coumarin affects phosphorylation ISO GAPDH (Homo sapiens) 6480464 coumarin affects the phosphorylation of GAPDH protein CTD PMID:35688186 Gapdh Rat crocidolite asbestos increases expression ISO GAPDH (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of GAPDH protein CTD PMID:29553831 Gapdh Rat crocidolite asbestos increases expression EXP 6480464 Asbestos and Crocidolite results in increased expression of GAPDH mRNA CTD PMID:8025751 Gapdh Rat cumene hydroperoxide increases expression ISO GAPDH (Homo sapiens) 6480464 cumene hydroperoxide results in increased expression of GAPDH protein CTD PMID:11295360 Gapdh Rat cyclosporin A increases expression ISO Gapdh (Mus musculus) 6480464 Cyclosporine results in increased expression of GAPDH mRNA CTD PMID:19770486 Gapdh Rat cytarabine decreases activity ISO GAPDH (Homo sapiens) 6480464 Cytarabine results in decreased activity of GAPDH protein CTD PMID:19628630 Gapdh Rat cytarabine affects localization ISO GAPDH (Homo sapiens) 6480464 Cytarabine affects the localization of GAPDH protein CTD PMID:19628630 Gapdh Rat cytarabine increases response to substance ISO GAPDH (Homo sapiens) 6480464 GAPDH protein results in increased susceptibility to Cytarabine CTD PMID:19628630 Gapdh Rat D-fructofuranose 1,6-bisphosphate multiple interactions EXP 6480464 [GAPDH protein co-treated with fructose-1 more ... CTD PMID:15788719 Gapdh Rat D-glucose increases expression ISO GAPDH (Homo sapiens) 6480464 Glucose results in increased expression of GAPDH mRNA CTD PMID:7826318 Gapdh Rat D-glucose increases ADP-ribosylation ISO Gapdh (Mus musculus) 6480464 Glucose results in increased ADP-ribosylation of GAPDH protein CTD PMID:14523042 Gapdh Rat D-glucose multiple interactions ISO Gapdh (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:14523042 and PMID:37567420 Gapdh Rat D-glucose multiple interactions ISO GAPDH (Homo sapiens) 6480464 SOD2 protein inhibits the reaction [[Glucose results in increased chemical synthesis of Superoxides] which results in decreased activity of GAPDH protein] and SOD2 protein inhibits the reaction [Glucose results in decreased activity of and results in increased ADP-ribosylation of GAPDH protein] CTD PMID:11050244 and PMID:14523042 Gapdh Rat D-glucose multiple interactions EXP 6480464 [chloroacetaldehyde results in decreased activity of GAPDH protein] which results in decreased chemical synthesis of Glucose more ... CTD PMID:11050244 more ... Gapdh Rat desferrioxamine B decreases expression ISO GAPDH (Homo sapiens) 6480464 Deferoxamine results in decreased expression of GAPDH protein CTD PMID:19515424 Gapdh Rat desferrioxamine B multiple interactions ISO GAPDH (Homo sapiens) 6480464 ferric ammonium citrate inhibits the reaction [Deferoxamine results in increased expression of GAPDH protein] CTD PMID:19515424 Gapdh Rat dexamethasone decreases expression ISO Gapdh (Mus musculus) 6480464 Dexamethasone results in decreased expression of GAPDH protein CTD PMID:33567340 Gapdh Rat dexamethasone multiple interactions ISO GAPDH (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of GAPDH mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GAPDH mRNA CTD PMID:28628672 Gapdh Rat diallyl trisulfide decreases expression ISO GAPDH (Homo sapiens) 6480464 diallyl trisulfide results in decreased expression of GAPDH protein CTD PMID:16344271 Gapdh Rat diarsenic trioxide multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of GAPDH protein more ... CTD PMID:26598702 and PMID:38160894 Gapdh Rat diarsenic trioxide increases expression ISO Gapdh (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of GAPDH mRNA CTD PMID:35676786 Gapdh Rat diarsenic trioxide decreases expression ISO GAPDH (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of GAPDH mRNA and Arsenic Trioxide results in decreased expression of GAPDH protein CTD PMID:38160894 Gapdh Rat diarsenic trioxide decreases activity ISO Gapdh (Mus musculus) 6480464 Arsenic Trioxide results in decreased activity of GAPDH protein CTD PMID:15916724 Gapdh Rat diazinon affects expression EXP 6480464 Diazinon affects the expression of GAPDH mRNA CTD PMID:22546817 Gapdh Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of GAPDH mRNA CTD PMID:17379624 and PMID:21266533 Gapdh Rat dibutyl phthalate decreases expression ISO Gapdh (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of GAPDH mRNA CTD PMID:21266533 Gapdh Rat dichlorine multiple interactions EXP 6480464 [Ozone co-treated with Chlorine] results in decreased expression of GAPDH mRNA CTD PMID:18636392 Gapdh Rat diclofenac multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat diethyl maleate increases reduction ISO Gapdh (Mus musculus) 6480464 diethyl maleate results in increased reduction of GAPDH protein CTD PMID:19843705 Gapdh Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of GAPDH mRNA CTD PMID:37077353 Gapdh Rat dihydroartemisinin affects binding ISO GAPDH (Homo sapiens) 6480464 artenimol analog binds to GAPDH protein CTD PMID:26340163 Gapdh Rat Diisodecyl phthalate increases expression ISO Gapdh (Mus musculus) 6480464 diisodecyl phthalate results in increased expression of GAPDH mRNA CTD PMID:25270620 Gapdh Rat dimethyl sulfoxide affects expression ISO GAPDH (Homo sapiens) 6480464 Dimethyl Sulfoxide affects the expression of GAPDH mRNA CTD PMID:12843640 Gapdh Rat Diosbulbin B decreases expression ISO Gapdh (Mus musculus) 6480464 diosbulbin B results in decreased expression of GAPDH mRNA CTD PMID:32148032 Gapdh Rat dioxygen increases expression ISO GAPDH (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of GAPDH mRNA CTD PMID:10646848 more ... Gapdh Rat dioxygen multiple interactions ISO GAPDH (Homo sapiens) 6480464 [eprenetapopt co-treated with Cisplatin] inhibits the reaction [Oxygen deficiency results in increased expression of GAPDH mRNA] more ... CTD PMID:23880069 and PMID:29690507 Gapdh Rat dioxygen multiple interactions ISO Gapdh (Mus musculus) 6480464 HIF1A protein affects the reaction [Oxygen deficiency results in increased expression of GAPDH mRNA] CTD PMID:10646848 Gapdh Rat dioxygen increases expression ISO Gapdh (Mus musculus) 6480464 Oxygen deficiency results in increased expression of GAPDH mRNA CTD PMID:10646848 Gapdh Rat dioxygen increases expression EXP 6480464 Oxygen results in increased expression of GAPDH mRNA CTD PMID:22911455 Gapdh Rat dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate increases expression ISO GAPDH (Homo sapiens) 6480464 Antimony Potassium Tartrate results in increased expression of GAPDH mRNA CTD PMID:28713220 Gapdh Rat disodium selenite multiple interactions ISO Gapdh (Mus musculus) 6480464 Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat dizocilpine maleate increases expression EXP 6480464 Dizocilpine Maleate results in increased expression of GAPDH protein CTD PMID:21297352 Gapdh Rat dopamine increases expression ISO GAPDH (Homo sapiens) 6480464 Dopamine results in increased expression of GAPDH protein CTD PMID:24675778 Gapdh Rat doxorubicin multiple interactions ISO Gapdh (Mus musculus) 6480464 [docetaxel co-treated with Doxorubicin] results in increased expression of GAPDH protein CTD PMID:20457137 Gapdh Rat doxorubicin increases expression ISO GAPDH (Homo sapiens) 6480464 Doxorubicin results in increased expression of GAPDH mRNA CTD PMID:29803840 Gapdh Rat elemental selenium increases expression ISO GAPDH (Homo sapiens) 6480464 Selenium results in increased expression of GAPDH mRNA CTD PMID:19244175 Gapdh Rat enzyme inhibitor multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of GAPDH protein CTD PMID:23301498 Gapdh Rat ethanol increases expression EXP 6480464 Ethanol results in increased expression of GAPDH protein CTD PMID:23702218 Gapdh Rat ethanol increases expression ISO Gapdh (Mus musculus) 6480464 Ethanol results in increased expression of GAPDH mRNA CTD PMID:30319688 Gapdh Rat ethanol affects splicing ISO Gapdh (Mus musculus) 6480464 Ethanol affects the splicing of GAPDH mRNA CTD PMID:30319688 Gapdh Rat ethanol decreases expression EXP 6480464 Ethanol results in decreased expression of GAPDH protein CTD PMID:12700235 Gapdh Rat ethanol decreases expression ISO Gapdh (Mus musculus) 6480464 Ethanol results in decreased expression of GAPDH mRNA CTD PMID:28962519 Gapdh Rat ethanol multiple interactions ISO Gapdh (Mus musculus) 6480464 Ethanol results in decreased expression of and results in decreased activity of GAPDH protein more ... CTD PMID:28962519 Gapdh Rat etoposide increases expression ISO Gapdh (Mus musculus) 6480464 Etoposide results in increased expression of GAPDH protein CTD PMID:29733421 Gapdh Rat fenbuconazole increases expression ISO GAPDH (Homo sapiens) 6480464 fenbuconazole results in increased expression of GAPDH mRNA CTD PMID:15942997 Gapdh Rat fenthion increases expression ISO Gapdh (Mus musculus) 6480464 Fenthion results in increased expression of GAPDH mRNA CTD PMID:34813904 Gapdh Rat fentin chloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 triphenyltin chloride promotes the reaction [Tretinoin results in decreased expression of GAPDH protein] CTD PMID:30806631 Gapdh Rat fentin chloride decreases expression ISO GAPDH (Homo sapiens) 6480464 triphenyltin chloride results in decreased expression of GAPDH protein CTD PMID:30806631 Gapdh Rat ferric ammonium citrate multiple interactions ISO GAPDH (Homo sapiens) 6480464 ferric ammonium citrate inhibits the reaction [Deferoxamine results in increased expression of GAPDH protein] CTD PMID:19515424 Gapdh Rat flavonoids decreases expression EXP 6480464 Flavonoids results in decreased expression of GAPDH mRNA CTD PMID:18035473 Gapdh Rat flumequine multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of GAPDH mRNA CTD PMID:21525395 and PMID:24136188 Gapdh Rat folic acid decreases expression ISO Gapdh (Mus musculus) 6480464 Folic Acid results in decreased expression of GAPDH mRNA CTD PMID:25629700 Gapdh Rat folic acid multiple interactions ISO Gapdh (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of GAPDH mRNA CTD PMID:22206623 Gapdh Rat folpet increases expression ISO Gapdh (Mus musculus) 6480464 folpet results in increased expression of GAPDH mRNA CTD PMID:31558096 Gapdh Rat FR900359 affects phosphorylation ISO GAPDH (Homo sapiens) 6480464 FR900359 affects the phosphorylation of GAPDH protein CTD PMID:37730182 Gapdh Rat fructose multiple interactions ISO Gapdh (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of GAPDH mRNA CTD PMID:37567420 Gapdh Rat furan increases expression EXP 6480464 furan results in increased expression of GAPDH mRNA CTD PMID:15120968 Gapdh Rat furan affects activity EXP 6480464 furan affects the activity of GAPDH protein CTD PMID:27402187 Gapdh Rat furan affects binding EXP 6480464 furan binds to GAPDH protein CTD PMID:22240984 Gapdh Rat furfural multiple interactions ISO GAPDH (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Gapdh Rat genistein increases expression EXP 6480464 Genistein results in increased expression of GAPDH mRNA CTD PMID:17341692 Gapdh Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of GAPDH mRNA CTD PMID:24136188 Gapdh Rat glucose increases expression ISO GAPDH (Homo sapiens) 6480464 Glucose results in increased expression of GAPDH mRNA CTD PMID:7826318 Gapdh Rat glucose increases ADP-ribosylation ISO Gapdh (Mus musculus) 6480464 Glucose results in increased ADP-ribosylation of GAPDH protein CTD PMID:14523042 Gapdh Rat glucose multiple interactions ISO GAPDH (Homo sapiens) 6480464 SOD2 protein inhibits the reaction [[Glucose results in increased chemical synthesis of Superoxides] which results in decreased activity of GAPDH protein] and SOD2 protein inhibits the reaction [Glucose results in decreased activity of and results in increased ADP-ribosylation of GAPDH protein] CTD PMID:11050244 and PMID:14523042 Gapdh Rat glucose multiple interactions EXP 6480464 [chloroacetaldehyde results in decreased activity of GAPDH protein] which results in decreased chemical synthesis of Glucose more ... CTD PMID:11050244 more ... Gapdh Rat glucose multiple interactions ISO Gapdh (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:14523042 and PMID:37567420 Gapdh Rat glutathione multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Buthionine Sulfoximine results in decreased abundance of Glutathione] promotes the reaction [1 more ... CTD PMID:15788719 and PMID:21827172 Gapdh Rat glutathione multiple interactions EXP 6480464 Glutathione inhibits the reaction [arsenite results in decreased expression of GAPDH protein] CTD PMID:15175009 Gapdh Rat glyceraldehyde 3-phosphate multiple interactions ISO GAPDH (Homo sapiens) 6480464 [GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog more ... CTD PMID:15788719 Gapdh Rat gold atom decreases expression ISO Gapdh (Mus musculus) 6480464 Gold analog results in decreased expression of GAPDH protein CTD PMID:24780912 Gapdh Rat gold(0) decreases expression ISO Gapdh (Mus musculus) 6480464 Gold analog results in decreased expression of GAPDH protein CTD PMID:24780912 Gapdh Rat graphite decreases expression ISO GAPDH (Homo sapiens) 6480464 Graphite results in decreased expression of GAPDH protein CTD PMID:22157353 Gapdh Rat haloperidol increases expression EXP 6480464 Haloperidol results in increased expression of GAPDH mRNA CTD PMID:15860345 Gapdh Rat Heptelidic acid multiple interactions EXP 6480464 heptelidic acid inhibits the reaction [[GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased reduction of sodium arsenate analog] more ... CTD PMID:15788719 Gapdh Rat Heptelidic acid decreases activity EXP 6480464 heptelidic acid results in decreased activity of GAPDH protein CTD PMID:15788719 Gapdh Rat hydrogen peroxide increases expression ISO GAPDH (Homo sapiens) 6480464 Hydrogen Peroxide results in increased expression of GAPDH mRNA and Hydrogen Peroxide results in increased expression of GAPDH protein CTD PMID:11295360 more ... Gapdh Rat hydrogen peroxide affects expression ISO Gapdh (Mus musculus) 6480464 Hydrogen Peroxide affects the expression of GAPDH protein CTD PMID:16876868 Gapdh Rat hydrogen peroxide multiple interactions ISO GAPDH (Homo sapiens) 6480464 chromium histidinate inhibits the reaction [Hydrogen Peroxide results in increased expression of GAPDH mRNA] CTD PMID:19902159 Gapdh Rat hydrogen peroxide decreases expression ISO GAPDH (Homo sapiens) 6480464 Hydrogen Peroxide results in decreased expression of GAPDH mRNA CTD PMID:12419474 Gapdh Rat hydroxyurea decreases activity ISO Gapdh (Mus musculus) 6480464 Hydroxyurea results in decreased activity of GAPDH protein CTD PMID:20889679 Gapdh Rat hydroxyurea multiple interactions ISO Gapdh (Mus musculus) 6480464 [Hydroxyurea promotes the reaction [4-hydroxy-2-nonenal binds to GAPDH protein]] which results in decreased activity of GAPDH protein more ... CTD PMID:20889679 and PMID:23696560 Gapdh Rat hydroxyurea affects localization ISO Gapdh (Mus musculus) 6480464 Hydroxyurea affects the localization of GAPDH protein CTD PMID:20889679 Gapdh Rat indometacin multiple interactions ISO GAPDH (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of GAPDH mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GAPDH mRNA CTD PMID:28628672 Gapdh Rat isoflavones multiple interactions EXP 6480464 [9 more ... CTD PMID:22248470 Gapdh Rat isoniazide increases expression EXP 6480464 Isoniazid results in increased expression of GAPDH mRNA CTD PMID:12883083 Gapdh Rat ivermectin decreases expression ISO GAPDH (Homo sapiens) 6480464 Ivermectin results in decreased expression of GAPDH protein CTD PMID:32959892 Gapdh Rat keto-D-fructose 1,6-bisphosphate multiple interactions EXP 6480464 [GAPDH protein co-treated with fructose-1 more ... CTD PMID:15788719 Gapdh Rat ketoconazole increases expression EXP 6480464 Ketoconazole results in increased expression of GAPDH mRNA CTD PMID:37077353 Gapdh Rat L-ascorbic acid increases expression ISO Gapdh (Mus musculus) 6480464 Ascorbic Acid results in increased expression of GAPDH protein CTD PMID:22139585 Gapdh Rat L-ascorbic acid decreases expression ISO GAPDH (Homo sapiens) 6480464 Ascorbic Acid results in decreased expression of GAPDH mRNA and Ascorbic Acid results in decreased expression of GAPDH protein CTD PMID:38160894 Gapdh Rat L-ascorbic acid multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Ascorbic Acid co-treated with Arsenic Trioxide] results in decreased expression of GAPDH protein more ... CTD PMID:38160894 Gapdh Rat L-ethionine affects expression EXP 6480464 Ethionine affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat lanthanum trichloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 [cerous chloride co-treated with lanthanum chloride] results in decreased expression of GAPDH mRNA CTD PMID:28954213 Gapdh Rat lead diacetate increases expression ISO Gapdh (Mus musculus) 6480464 lead acetate results in increased expression of GAPDH protein CTD PMID:20797405 Gapdh Rat lead(0) affects binding ISO GAPDH (Homo sapiens) 6480464 GAPDH protein binds to Lead CTD PMID:23896426 Gapdh Rat lipopolysaccharide multiple interactions ISO GAPDH (Homo sapiens) 6480464 [NAT10 protein affects the susceptibility to Lipopolysaccharides] which affects the expression of GAPDH mRNA CTD PMID:35877022 Gapdh Rat Macrosphelide A affects binding ISO GAPDH (Homo sapiens) 6480464 macrosphelide A binds to GAPDH protein CTD PMID:34681284 Gapdh Rat mebendazole decreases expression ISO GAPDH (Homo sapiens) 6480464 Mebendazole results in decreased expression of GAPDH mRNA CTD PMID:37473966 Gapdh Rat mebendazole affects binding ISO GAPDH (Homo sapiens) 6480464 Mebendazole binds to GAPDH protein CTD PMID:37473966 Gapdh Rat mercaptopurine affects localization ISO GAPDH (Homo sapiens) 6480464 Mercaptopurine affects the localization of GAPDH protein CTD PMID:19628630 Gapdh Rat mercury atom multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat mercury(0) multiple interactions ISO Gapdh (Mus musculus) 6480464 [Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA and Sodium Selenite promotes the reaction [[Cadmium co-treated with Arsenic co-treated with Mercury co-treated with Diclofenac co-treated with flumequine] results in decreased expression of GAPDH mRNA] CTD PMID:38945390 Gapdh Rat methanol decreases expression EXP 6480464 Methanol results in decreased expression of GAPDH protein CTD PMID:22257634 Gapdh Rat methoxychlor increases methylation EXP 6480464 Methoxychlor results in increased methylation of GAPDH gene CTD PMID:23303685 Gapdh Rat mono(2-ethylhexyl) phthalate increases expression ISO Gapdh (Mus musculus) 6480464 mono-(2-ethylhexyl)phthalate results in increased expression of GAPDH protein CTD PMID:25543134 and PMID:27384973 Gapdh Rat monocrotophos increases activity EXP 6480464 Monocrotophos results in increased activity of GAPDH protein CTD PMID:32207356 Gapdh Rat morphine decreases expression EXP 6480464 Morphine results in decreased expression of GAPDH protein CTD PMID:23056601 Gapdh Rat N-acetyl-L-cysteine decreases expression EXP 6480464 Acetylcysteine results in decreased expression of GAPDH mRNA CTD PMID:11108245 Gapdh Rat N-acetyl-L-cysteine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [arsenite results in decreased expression of GAPDH protein] CTD PMID:15175009 Gapdh Rat N-methyl-4-phenylpyridinium multiple interactions ISO GAPDH (Homo sapiens) 6480464 Selegiline inhibits the reaction [1-Methyl-4-phenylpyridinium results in increased expression of GAPDH mRNA] CTD PMID:14724376 Gapdh Rat N-methyl-4-phenylpyridinium decreases expression ISO Gapdh (Mus musculus) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of GAPDH mRNA CTD PMID:22776087 Gapdh Rat N-methyl-4-phenylpyridinium increases expression ISO GAPDH (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of GAPDH mRNA and 1-Methyl-4-phenylpyridinium results in increased expression of GAPDH protein CTD PMID:14724376 and PMID:24675778 Gapdh Rat N-nitrosodiethylamine increases expression EXP 6480464 Diethylnitrosamine results in increased expression of GAPDH mRNA CTD PMID:20360939 Gapdh Rat N-nitrosomorpholine increases expression EXP 6480464 N-nitrosomorpholine results in increased expression of GAPDH protein CTD PMID:19716841 Gapdh Rat NAD zwitterion multiple interactions EXP 6480464 [GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased chemical synthesis of sodium arsenite more ... CTD PMID:15788719 Gapdh Rat NAD zwitterion multiple interactions ISO GAPDH (Homo sapiens) 6480464 [GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog more ... CTD PMID:15788719 Gapdh Rat NAD(+) multiple interactions EXP 6480464 [GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased chemical synthesis of sodium arsenite more ... CTD PMID:15788719 Gapdh Rat NAD(+) multiple interactions ISO GAPDH (Homo sapiens) 6480464 [GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog more ... CTD PMID:15788719 Gapdh Rat NADP zwitterion multiple interactions ISO GAPDH (Homo sapiens) 6480464 NADP inhibits the reaction [[GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog] CTD PMID:15788719 Gapdh Rat NADP(+) multiple interactions ISO GAPDH (Homo sapiens) 6480464 NADP inhibits the reaction [[GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog] CTD PMID:15788719 Gapdh Rat nickel dichloride increases expression ISO GAPDH (Homo sapiens) 6480464 nickel chloride results in increased expression of GAPDH mRNA CTD PMID:10646848 and PMID:23566959 Gapdh Rat nickel dichloride affects expression EXP 6480464 nickel chloride affects the expression of GAPDH mRNA CTD PMID:22546817 Gapdh Rat nickel dichloride increases expression ISO Gapdh (Mus musculus) 6480464 nickel chloride results in increased expression of GAPDH mRNA CTD PMID:10646848 more ... Gapdh Rat nickel dichloride multiple interactions ISO Gapdh (Mus musculus) 6480464 HIF1A affects the reaction [nickel chloride results in increased expression of GAPDH mRNA] and HIF1A protein affects the reaction [nickel chloride results in increased expression of GAPDH mRNA] CTD PMID:10646848 and PMID:12426141 Gapdh Rat nickel sulfate affects expression ISO Gapdh (Mus musculus) 6480464 nickel sulfate affects the expression of GAPDH mRNA CTD PMID:12718980 Gapdh Rat nicotine multiple interactions ISO Gapdh (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Gapdh Rat nilutamide multiple interactions EXP 6480464 nilutamide inhibits the reaction [Dihydrotestosterone results in decreased activity of GAPDH protein] CTD PMID:10650946 Gapdh Rat nitric oxide multiple interactions EXP 6480464 [7-nitroindazole results in decreased chemical synthesis of Nitric Oxide] inhibits the reaction [Paraquat affects the localization of GAPDH protein] CTD PMID:20478973 Gapdh Rat nitric oxide increases expression ISO Gapdh (Mus musculus) 6480464 Nitric Oxide deficiency results in increased expression of GAPDH mRNA CTD PMID:15878706 Gapdh Rat Nutlin-3 multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of GAPDH protein CTD PMID:38460933 Gapdh Rat obeticholic acid decreases expression ISO GAPDH (Homo sapiens) 6480464 obeticholic acid results in decreased expression of GAPDH mRNA CTD PMID:27939613 Gapdh Rat okadaic acid affects expression ISO GAPDH (Homo sapiens) 6480464 Okadaic Acid affects the expression of GAPDH mRNA CTD PMID:22788371 Gapdh Rat omeprazole affects expression EXP 6480464 Omeprazole affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of GAPDH mRNA and [Ozone co-treated with Chlorine] results in decreased expression of GAPDH mRNA CTD PMID:18636392 and PMID:37088303 Gapdh Rat ozone multiple interactions ISO Gapdh (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of GAPDH mRNA and [Air Pollutants results in increased abundance of Ozone] which results in increased expression of GAPDH mRNA CTD PMID:34911549 Gapdh Rat ozone increases expression ISO GAPDH (Homo sapiens) 6480464 Ozone results in increased expression of GAPDH mRNA CTD PMID:23033980 Gapdh Rat p-menthan-3-ol increases expression ISO GAPDH (Homo sapiens) 6480464 Menthol results in increased expression of GAPDH mRNA CTD PMID:26760959 Gapdh Rat p-tert-Amylphenol increases expression EXP 6480464 4-tert-octylphenol results in increased expression of GAPDH mRNA CTD PMID:10822019 Gapdh Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of GAPDH mRNA and Acetaminophen results in increased expression of GAPDH protein CTD PMID:15800402 and PMID:22563491 Gapdh Rat paraquat multiple interactions EXP 6480464 [7-nitroindazole results in decreased chemical synthesis of Nitric Oxide] inhibits the reaction [Paraquat affects the localization of GAPDH protein] and Selegiline inhibits the reaction [Paraquat affects the localization of GAPDH protein] CTD PMID:20478973 Gapdh Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of GAPDH mRNA CTD PMID:32680482 Gapdh Rat paraquat affects localization EXP 6480464 Paraquat affects the localization of GAPDH protein CTD PMID:20478973 Gapdh Rat PCB138 decreases expression EXP 6480464 2 more ... CTD PMID:21673325 Gapdh Rat pepstatin A multiple interactions ISO GAPDH (Homo sapiens) 6480464 pepstatin inhibits the reaction [syringic acid analog results in increased secretion of GAPDH protein] CTD PMID:34523043 Gapdh Rat perfluorohexanesulfonic acid increases expression ISO GAPDH (Homo sapiens) 6480464 perfluorohexanesulfonic acid results in increased expression of GAPDH mRNA CTD PMID:23567314 Gapdh Rat perfluorooctane-1-sulfonic acid affects expression ISO Gapdh (Mus musculus) 6480464 perfluorooctane sulfonic acid affects the expression of GAPDH mRNA CTD PMID:19429403 Gapdh Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Gapdh (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of GAPDH mRNA CTD PMID:36331819 Gapdh Rat perfluorooctanoic acid increases expression EXP 6480464 perfluorooctanoic acid results in increased expression of GAPDH mRNA and perfluorooctanoic acid results in increased expression of GAPDH protein CTD PMID:19616056 and PMID:21723365 Gapdh Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of GAPDH mRNA CTD PMID:35163327 Gapdh Rat perfluorooctanoic acid affects expression ISO Gapdh (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of GAPDH mRNA CTD PMID:19429403 Gapdh Rat pirinixic acid affects expression EXP 6480464 pirinixic acid affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat polymyxin B2 multiple interactions ISO Gapdh (Mus musculus) 6480464 Polymyxin B inhibits the reaction [Alpha-Amanitin results in decreased expression of GAPDH mRNA] CTD PMID:26385100 Gapdh Rat potassium dichromate increases expression EXP 6480464 Potassium Dichromate results in increased expression of GAPDH protein CTD PMID:18563748 Gapdh Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of GAPDH mRNA CTD PMID:16376865 Gapdh Rat promethazine decreases expression EXP 6480464 Promethazine results in decreased expression of GAPDH mRNA CTD PMID:28903497 Gapdh Rat prostaglandin A1 increases metabolic processing ISO Gapdh (Mus musculus) 6480464 prostaglandin A1 analog results in increased metabolism of GAPDH protein CTD PMID:19800325 Gapdh Rat purine-6-thiol affects localization ISO GAPDH (Homo sapiens) 6480464 Mercaptopurine affects the localization of GAPDH protein CTD PMID:19628630 Gapdh Rat pyrrolidine dithiocarbamate increases expression EXP 6480464 pyrrolidine dithiocarbamic acid results in increased expression of GAPDH mRNA CTD PMID:11108245 Gapdh Rat quercetin increases expression ISO GAPDH (Homo sapiens) 6480464 Quercetin results in increased expression of GAPDH protein CTD PMID:19207037 Gapdh Rat quercetin decreases expression EXP 6480464 Quercetin results in decreased expression of GAPDH protein CTD PMID:18095365 Gapdh Rat Rebamipide increases expression EXP 6480464 rebamipide results in increased expression of GAPDH mRNA CTD PMID:18299717 Gapdh Rat resveratrol affects expression EXP 6480464 resveratrol affects the expression of GAPDH mRNA CTD PMID:15748624 Gapdh Rat retinyl acetate increases expression ISO Gapdh (Mus musculus) 6480464 retinol acetate results in increased expression of GAPDH mRNA CTD PMID:16772331 Gapdh Rat rimonabant increases expression ISO Gapdh (Mus musculus) 6480464 Rimonabant results in increased expression of GAPDH mRNA CTD PMID:16282221 Gapdh Rat rotenone affects localization EXP 6480464 Rotenone affects the localization of GAPDH protein CTD PMID:19445904 Gapdh Rat rotenone multiple interactions ISO GAPDH (Homo sapiens) 6480464 [GAPDH protein polymorphism co-treated with Rotenone] results in decreased expression of BCL2 protein more ... CTD PMID:29886133 Gapdh Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of GAPDH mRNA and Rotenone results in increased expression of GAPDH protein CTD PMID:19445904 and PMID:21736921 Gapdh Rat rotenone multiple interactions EXP 6480464 GAPDH mutant form inhibits the reaction [Rotenone results in increased expression of and results in increased activity of CASP3 protein] more ... CTD PMID:19445904 more ... Gapdh Rat rotenone decreases activity EXP 6480464 Rotenone results in decreased activity of GAPDH protein CTD PMID:19445904 and PMID:21736921 Gapdh Rat S-butyl-DL-homocysteine (S,R)-sulfoximine multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Buthionine Sulfoximine results in decreased abundance of Glutathione] promotes the reaction [1 more ... CTD PMID:21827172 Gapdh Rat S-butyl-DL-homocysteine (S,R)-sulfoximine increases expression ISO Gapdh (Mus musculus) 6480464 Buthionine Sulfoximine results in increased expression of GAPDH mRNA CTD PMID:15878706 Gapdh Rat Salinomycin decreases expression ISO GAPDH (Homo sapiens) 6480464 salinomycin results in decreased expression of GAPDH mRNA CTD PMID:19682730 Gapdh Rat selenium atom increases expression ISO GAPDH (Homo sapiens) 6480464 Selenium results in increased expression of GAPDH mRNA CTD PMID:19244175 Gapdh Rat serotonin multiple interactions ISO GAPDH (Homo sapiens) 6480464 [MPO protein co-treated with XDH protein co-treated with Acetaldehyde co-treated with Serotonin] affects the metabolism of and binds to GAPDH protein more ... CTD PMID:23009681 Gapdh Rat serpentine asbestos increases expression EXP 6480464 Asbestos and Serpentine results in increased expression of GAPDH mRNA CTD PMID:7677184 Gapdh Rat silicon dioxide increases secretion ISO GAPDH (Homo sapiens) 6480464 Silicon Dioxide analog results in increased secretion of GAPDH protein CTD PMID:25895662 Gapdh Rat simvastatin decreases expression EXP 6480464 Simvastatin results in decreased expression of GAPDH mRNA CTD PMID:16414398 Gapdh Rat sodium arsenate multiple interactions EXP 6480464 [GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased reduction of sodium arsenate analog more ... CTD PMID:15788719 Gapdh Rat sodium arsenite multiple interactions ISO GAPDH (Homo sapiens) 6480464 [GAPDH protein co-treated with NAD co-treated with Glyceraldehyde 3-Phosphate co-treated with Glutathione] results in increased reduction of sodium arsenite analog more ... CTD PMID:15788719 Gapdh Rat sodium arsenite multiple interactions EXP 6480464 [GAPDH protein co-treated with 3-phosphoglycerate co-treated with NAD] results in increased chemical synthesis of sodium arsenite more ... CTD PMID:15788719 Gapdh Rat sodium arsenite affects expression ISO Gapdh (Mus musculus) 6480464 sodium arsenite affects the expression of GAPDH mRNA CTD PMID:17450228 Gapdh Rat sodium arsenite increases expression ISO GAPDH (Homo sapiens) 6480464 sodium arsenite results in increased expression of GAPDH mRNA and sodium arsenite results in increased expression of GAPDH protein CTD PMID:15899475 more ... Gapdh Rat sodium chloride multiple interactions ISO GAPDH (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of GAPDH protein more ... CTD PMID:38598786 Gapdh Rat sodium dichromate increases expression EXP 6480464 sodium bichromate results in increased expression of GAPDH mRNA CTD PMID:12325037 Gapdh Rat sodium dodecyl sulfate decreases expression EXP 6480464 Sodium Dodecyl Sulfate results in decreased expression of GAPDH mRNA CTD PMID:12815608 Gapdh Rat sodium fluoride increases expression ISO Gapdh (Mus musculus) 6480464 Sodium Fluoride results in increased expression of GAPDH protein CTD PMID:27548804 Gapdh Rat sucrose multiple interactions ISO Gapdh (Mus musculus) 6480464 GW 506033X inhibits the reaction [Sucrose affects the localization of GAPDH protein] CTD PMID:27920257 Gapdh Rat sucrose affects localization ISO Gapdh (Mus musculus) 6480464 Sucrose affects the localization of GAPDH protein CTD PMID:27920257 Gapdh Rat sulfasalazine decreases expression EXP 6480464 Sulfasalazine results in decreased expression of GAPDH protein CTD PMID:15928459 Gapdh Rat sunitinib increases expression ISO GAPDH (Homo sapiens) 6480464 Sunitinib results in increased expression of GAPDH mRNA CTD PMID:31533062 Gapdh Rat superoxide multiple interactions ISO GAPDH (Homo sapiens) 6480464 SOD2 protein inhibits the reaction [[Glucose results in increased chemical synthesis of Superoxides] which results in decreased activity of GAPDH protein] CTD PMID:11050244 Gapdh Rat superoxide multiple interactions EXP 6480464 UCP1 protein inhibits the reaction [[Glucose results in increased chemical synthesis of Superoxides] which results in decreased activity of GAPDH protein] CTD PMID:11050244 Gapdh Rat syringic acid multiple interactions ISO GAPDH (Homo sapiens) 6480464 aloxistatin inhibits the reaction [syringic acid analog results in increased secretion of GAPDH protein] more ... CTD PMID:34523043 Gapdh Rat syringic acid increases secretion ISO GAPDH (Homo sapiens) 6480464 syringic acid analog results in increased secretion of GAPDH protein CTD PMID:34523043 Gapdh Rat syringic acid increases secretion ISO Gapdh (Mus musculus) 6480464 syringic acid analog results in increased secretion of GAPDH protein CTD PMID:34523043 Gapdh Rat T-2 toxin affects expression EXP 6480464 T-2 Toxin affects the expression of GAPDH protein CTD PMID:26141394 Gapdh Rat T-2 toxin decreases expression EXP 6480464 T-2 Toxin results in decreased expression of GAPDH mRNA CTD PMID:26141394 Gapdh Rat tert-butyl hydroperoxide increases expression ISO GAPDH (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased expression of GAPDH protein CTD PMID:11295360 Gapdh Rat testosterone decreases activity EXP 6480464 Testosterone results in decreased activity of GAPDH protein CTD PMID:10650946 Gapdh Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of GAPDH mRNA CTD PMID:22563491 Gapdh Rat tetrachloromethane increases expression ISO Gapdh (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of GAPDH mRNA CTD PMID:31919559 Gapdh Rat tetraethylenepentamine multiple interactions ISO GAPDH (Homo sapiens) 6480464 tetraethylenepentamine inhibits the reaction [cobaltous chloride results in increased expression of GAPDH mRNA] CTD PMID:25100165 Gapdh Rat thapsigargin increases expression EXP 6480464 Thapsigargin results in increased expression of GAPDH protein CTD PMID:35544339 Gapdh Rat thioacetamide affects expression EXP 6480464 Thioacetamide affects the expression of GAPDH mRNA CTD PMID:19483382 Gapdh Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of GAPDH mRNA CTD PMID:28903497 Gapdh Rat thiram decreases expression ISO GAPDH (Homo sapiens) 6480464 Thiram results in decreased expression of GAPDH mRNA CTD PMID:38568856 Gapdh Rat titanium dioxide increases expression ISO Gapdh (Mus musculus) 6480464 titanium dioxide results in increased expression of GAPDH mRNA CTD PMID:23131501 Gapdh Rat titanium dioxide decreases methylation ISO Gapdh (Mus musculus) 6480464 titanium dioxide results in decreased methylation of GAPDH gene CTD PMID:35295148 Gapdh Rat tributylstannane multiple interactions ISO GAPDH (Homo sapiens) 6480464 tributyltin promotes the reaction [Tretinoin results in decreased expression of GAPDH protein] CTD PMID:30806631 Gapdh Rat tributylstannane decreases expression ISO GAPDH (Homo sapiens) 6480464 tributyltin results in decreased expression of GAPDH protein CTD PMID:30806631 Gapdh Rat Tributyltin oxide decreases expression EXP 6480464 bis(tri-n-butyltin)oxide results in decreased expression of GAPDH mRNA CTD PMID:17553608 Gapdh Rat trichostatin A decreases expression ISO GAPDH (Homo sapiens) 6480464 trichostatin A results in decreased expression of GAPDH protein CTD PMID:19294695 Gapdh Rat trimellitic anhydride increases expression ISO Gapdh (Mus musculus) 6480464 trimellitic anhydride results in increased expression of GAPDH mRNA CTD PMID:19042947 Gapdh Rat triphenyl phosphate affects expression ISO GAPDH (Homo sapiens) 6480464 triphenyl phosphate affects the expression of GAPDH mRNA CTD PMID:37042841 Gapdh Rat triphenylstannane decreases expression ISO GAPDH (Homo sapiens) 6480464 triphenyltin analog results in decreased expression of GAPDH protein CTD PMID:31634547 Gapdh Rat trovafloxacin decreases expression EXP 6480464 trovafloxacin results in decreased expression of GAPDH mRNA CTD PMID:24136188 Gapdh Rat vanillin multiple interactions ISO GAPDH (Homo sapiens) 6480464 vanillin inhibits the reaction [Cadmium Chloride results in decreased activity of GAPDH protein] CTD PMID:37336463 Gapdh Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of GAPDH mRNA CTD PMID:19015723 Gapdh Rat vitamin E increases expression ISO GAPDH (Homo sapiens) 6480464 Vitamin E results in increased expression of GAPDH mRNA CTD PMID:19244175 Gapdh Rat zearalenone decreases expression ISO Gapdh (Mus musculus) 6480464 Zearalenone results in decreased expression of GAPDH protein CTD PMID:36252740 Gapdh Rat zinc atom affects binding ISO GAPDH (Homo sapiens) 6480464 GAPDH protein binds to Zinc CTD PMID:14534351 Gapdh Rat zinc(0) affects binding ISO GAPDH (Homo sapiens) 6480464 GAPDH protein binds to Zinc CTD PMID:14534351
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
(-)-selegiline (EXP,ISO) (1->4)-beta-D-glucan (ISO) (S)-nicotine (ISO) 1,10-phenanthroline (ISO) 1,2-dimethylhydrazine (ISO) 1,2-naphthoquinone (ISO) 1,3-dinitrobenzene (EXP) 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (ISO) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,3-dimethoxynaphthalene-1,4-dione (ISO) 2,4,6-trinitrotoluene (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP,ISO) 2,5-hexanedione (EXP) 2,6-dimethoxyphenol (ISO) 2,6-dinitrotoluene (EXP) 2-bromohexadecanoic acid (EXP) 2-methoxyethanol (EXP) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,7-dihydropurine-6-thione (ISO) 3-bromopyruvic acid (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3-nitropropanoic acid (EXP) 3-phosphoglyceric acid (EXP) 3H-1,2-dithiole-3-thione (EXP) 4,4'-sulfonyldiphenol (EXP,ISO) 4-amino-2,6-dinitrotoluene (EXP) 4-hydroxynon-2-enal (ISO) 4-tert-Octylphenol (EXP) 5-aza-2'-deoxycytidine (ISO) 5-fluorouracil (ISO) 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole (EXP) 6-propyl-2-thiouracil (EXP) 7,12-dimethyltetraphene (EXP,ISO) 7-nitroindazole (EXP) 9-cis-retinoic acid (ISO) acetaldehyde (ISO) acetamide (EXP) acetic acid (ISO) acrolein (EXP,ISO) acrylamide (EXP,ISO) actinomycin D (ISO) ADP (ISO) aflatoxin B1 (ISO) aldehydo-D-glucose (EXP,ISO) all-trans-retinoic acid (EXP,ISO) aloxistatin (ISO) alpha-amanitin (ISO) alpha-hexachlorocyclohexane (EXP) alpha-Zearalanol (EXP) amiodarone (EXP) ammonium chloride (EXP) amphetamine (EXP) aristolochic acid A (ISO) Aroclor 1254 (EXP,ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (EXP) arsenous acid (ISO) ATP (ISO) benzbromarone (EXP) benzo[a]pyrene (ISO) beta-D-fructofuranose 1,6-bisphosphate (EXP) beta-lapachone (ISO) beta-naphthoflavone (ISO) bis(2-chloroethyl) sulfide (EXP,ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (EXP,ISO) boric acid (ISO) bromochloroacetic acid (ISO) buten-2-one (ISO) cadmium atom (EXP,ISO) cadmium dichloride (EXP,ISO) caffeine (ISO) capsaicin (EXP,ISO) captan (ISO) carbon nanotube (ISO) celastrol (ISO) cerium trichloride (ISO) chloroacetaldehyde (EXP) chloroacetic acid (EXP) chloropicrin (ISO) chlorpyrifos (ISO) cisplatin (ISO) clofibrate (EXP) clozapine (EXP,ISO) cobalt dichloride (ISO) cobalt(2+) sulfate (ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) coumarin (ISO) crocidolite asbestos (EXP,ISO) cumene hydroperoxide (ISO) cyclosporin A (ISO) cytarabine (ISO) D-fructofuranose 1,6-bisphosphate (EXP) D-glucose (EXP,ISO) desferrioxamine B (ISO) dexamethasone (ISO) diallyl trisulfide (ISO) diarsenic trioxide (ISO) diazinon (EXP) dibutyl phthalate (EXP,ISO) dichlorine (EXP) diclofenac (ISO) diethyl maleate (ISO) diethylstilbestrol (EXP) dihydroartemisinin (ISO) Diisodecyl phthalate (ISO) dimethyl sulfoxide (ISO) Diosbulbin B (ISO) dioxygen (EXP,ISO) dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate (ISO) disodium selenite (ISO) dizocilpine maleate (EXP) dopamine (ISO) doxorubicin (ISO) elemental selenium (ISO) enzyme inhibitor (ISO) ethanol (EXP,ISO) etoposide (ISO) fenbuconazole (ISO) fenthion (ISO) fentin chloride (ISO) ferric ammonium citrate (ISO) flavonoids (EXP) flumequine (ISO) flutamide (EXP) folic acid (ISO) folpet (ISO) FR900359 (ISO) fructose (ISO) furan (EXP) furfural (ISO) genistein (EXP) glafenine (EXP) glucose (EXP,ISO) glutathione (EXP,ISO) glyceraldehyde 3-phosphate (ISO) gold atom (ISO) gold(0) (ISO) graphite (ISO) haloperidol (EXP) Heptelidic acid (EXP) hydrogen peroxide (ISO) hydroxyurea (ISO) indometacin (ISO) isoflavones (EXP) isoniazide (EXP) ivermectin (ISO) keto-D-fructose 1,6-bisphosphate (EXP) ketoconazole (EXP) L-ascorbic acid (ISO) L-ethionine (EXP) lanthanum trichloride (ISO) lead diacetate (ISO) lead(0) (ISO) lipopolysaccharide (ISO) Macrosphelide A (ISO) mebendazole (ISO) mercaptopurine (ISO) mercury atom (ISO) mercury(0) (ISO) methanol (EXP) methoxychlor (EXP) mono(2-ethylhexyl) phthalate (ISO) monocrotophos (EXP) morphine (EXP) N-acetyl-L-cysteine (EXP) N-methyl-4-phenylpyridinium (ISO) N-nitrosodiethylamine (EXP) N-nitrosomorpholine (EXP) NAD zwitterion (EXP,ISO) NAD(+) (EXP,ISO) NADP zwitterion (ISO) NADP(+) (ISO) nickel dichloride (EXP,ISO) nickel sulfate (ISO) nicotine (ISO) nilutamide (EXP) nitric oxide (EXP,ISO) Nutlin-3 (ISO) obeticholic acid (ISO) okadaic acid (ISO) omeprazole (EXP) ozone (EXP,ISO) p-menthan-3-ol (ISO) p-tert-Amylphenol (EXP) paracetamol (EXP) paraquat (EXP) PCB138 (EXP) pepstatin A (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP,ISO) pirinixic acid (EXP) polymyxin B2 (ISO) potassium dichromate (EXP) progesterone (EXP) promethazine (EXP) prostaglandin A1 (ISO) purine-6-thiol (ISO) pyrrolidine dithiocarbamate (EXP) quercetin (EXP,ISO) Rebamipide (EXP) resveratrol (EXP) retinyl acetate (ISO) rimonabant (ISO) rotenone (EXP,ISO) S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO) Salinomycin (ISO) selenium atom (ISO) serotonin (ISO) serpentine asbestos (EXP) silicon dioxide (ISO) simvastatin (EXP) sodium arsenate (EXP) sodium arsenite (EXP,ISO) sodium chloride (ISO) sodium dichromate (EXP) sodium dodecyl sulfate (EXP) sodium fluoride (ISO) sucrose (ISO) sulfasalazine (EXP) sunitinib (ISO) superoxide (EXP,ISO) syringic acid (ISO) T-2 toxin (EXP) tert-butyl hydroperoxide (ISO) testosterone (EXP) tetrachloromethane (EXP,ISO) tetraethylenepentamine (ISO) thapsigargin (EXP) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) tributylstannane (ISO) Tributyltin oxide (EXP) trichostatin A (ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) triphenylstannane (ISO) trovafloxacin (EXP) vanillin (ISO) vinclozolin (EXP) vitamin E (ISO) zearalenone (ISO) zinc atom (ISO) zinc(0) (ISO)
1.
Association and heterogeneity at the GAPDH locus in Alzheimer's disease.
Allen M, etal., Neurobiol Aging. 2012 Jan;33(1):203.e25-33. doi: 10.1016/j.neurobiolaging.2010.08.002. Epub 2010 Sep 23.
2.
Interactions among p22, glyceraldehyde-3-phosphate dehydrogenase and microtubules.
Andrade J, etal., Biochem J. 2004 Dec 1;384(Pt 2):327-36.
3.
Glyceraldehyde-3-phosphate dehydrogenase interacts with phosphorylated Akt resulting from increased blood glucose in rat cardiac muscle.
Baba T, etal., FEBS Lett. 2010 Jul 2;584(13):2796-800. doi: 10.1016/j.febslet.2010.05.015. Epub 2010 May 17.
4.
Lysine post-translational modification of glyceraldehyde-3-phosphate dehydrogenase regulates hepatic and systemic metabolism.
Bond ST, etal., FASEB J. 2017 Jun;31(6):2592-2602. doi: 10.1096/fj.201601215R. Epub 2017 Mar 3.
5.
Key enzymes of carbohydrate metabolism as targets of the 11.5-kDa Zn(2+)-binding protein (parathymosin).
Brand IA and Heinickel A, J Biol Chem. 1991 Nov 5;266(31):20984-9.
6.
Interaction of glyceraldehyde-3-phosphate dehydrogenase in the light-induced rod alpha-transducin translocation.
Chen J, etal., J Neurochem. 2008 Mar;104(5):1280-92. Epub 2007 Nov 17.
7.
Increased myocardial expression of RAMP1 and RAMP3 in rats with chronic heart failure.
Cueille C, etal., Biochem Biophys Res Commun 2002 Jun 7;294(2):340-6.
8.
Assessment of GAPDH expression by quantitative real time PCR in blood of Moroccan AD cases.
El Kadmiri N, etal., J Clin Neurosci. 2017 Jun;40:24-26. doi: 10.1016/j.jocn.2016.12.007. Epub 2017 Jan 10.
9.
Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene.
Ercolani L, etal., J Biol Chem 1988 Oct 25;263(30):15335-41.
10.
Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family.
Fort P, etal., Nucleic Acids Res 1985 Mar 11;13(5):1431-42.
11.
Insulin-dependent interactions of proteins with GLUT4 revealed through stable isotope labeling by amino acids in cell culture (SILAC).
Foster LJ, etal., J Proteome Res. 2006 Jan;5(1):64-75.
12.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
13.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
14.
Spatial profiles of markers of glycolysis, mitochondria, and proton pumps in a rat glioma suggest coordinated programming for proliferation.
Grillon E, etal., BMC Res Notes. 2015 Jun 2;8:207. doi: 10.1186/s13104-015-1191-z.
15.
S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding.
Hara MR, etal., Nat Cell Biol. 2005 Jul;7(7):665-74. Epub 2005 Jun 12.
16.
Nuclear complex of glyceraldehyde-3-phosphate dehydrogenase and DNA repair enzyme apurinic/apyrimidinic endonuclease I protect smooth muscle cells against oxidant-induced cell death.
Hou X, etal., FASEB J. 2017 Jul;31(7):3179-3192. doi: 10.1096/fj.201601082R. Epub 2017 Apr 12.
17.
Inhibiting a spinal cord signaling pathway protects against ischemia injury in rats.
Huo J, etal., J Thorac Cardiovasc Surg. 2018 Jul 30. pii: S0022-5223(18)32035-X. doi: 10.1016/j.jtcvs.2018.07.045.
18.
GAPDH/Siah1 cascade is involved in traumatic spinal cord injury and could be attenuated by sivelestat sodium.
Huo J, etal., Neuroscience. 2016 Aug 25;330:171-80. doi: 10.1016/j.neuroscience.2016.05.054. Epub 2016 May 30.
19.
Impaired GAPDH-induced mitophagy contributes to the pathology of Huntington's disease.
Hwang S, etal., EMBO Mol Med. 2015 Oct;7(10):1307-26. doi: 10.15252/emmm.201505256.
20.
Identification of major Ca(2+)/calmodulin-dependent protein kinase phosphatase-binding proteins in brain: biochemical analysis of the interaction.
Ishida A, etal., Arch Biochem Biophys. 2005 Mar 1;435(1):134-46.
21.
Identification of Ca2+-dependent binding partners for the neuronal calcium sensor protein neurocalcin delta: interaction with actin, clathrin and tubulin.
Ivings L, etal., Biochem J 2002 May 1;363(Pt 3):599-608.
22.
Role of glyceraldehyde 3-phosphate dehydrogenase in the development and progression of diabetic retinopathy.
Kanwar M and Kowluru RA, Diabetes. 2009 Jan;58(1):227-34. Epub 2008 Oct 13.
23.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
24.
GAPDH mediates nitrosylation of nuclear proteins.
Kornberg MD, etal., Nat Cell Biol. 2010 Nov;12(11):1094-100. doi: 10.1038/ncb2114. Epub 2010 Oct 24.
25.
In situ analysis of mTORC1/2 and cellular metabolism-related proteins in human Lymphangioleiomyomatosis.
Krencz I, etal., Hum Pathol. 2018 Sep;79:199-207. doi: 10.1016/j.humpath.2018.05.018. Epub 2018 Jun 6.
26.
Further examination of the candidate genes in chromosome 12p13 locus for late-onset Alzheimer disease.
Lee JH, etal., Neurogenetics. 2008 May;9(2):127-38. doi: 10.1007/s10048-008-0122-8. Epub 2008 Mar 14.
27.
Trifluoperazine activates and releases latent ATP-generating enzymes associated with the synaptic plasma membrane.
Leung TK, etal., J Neurochem 1987 Jul;49(1):232-8.
28.
Proteomic analysis of mitral valve in Lewis rat with acute rheumatic heart disease.
Li W, etal., Int J Clin Exp Pathol. 2015 Nov 1;8(11):14151-60. eCollection 2015.
29.
Association of late-onset Alzheimer's disease with genetic variation in multiple members of the GAPD gene family.
Li Y, etal., Proc Natl Acad Sci U S A 2004 Nov 2;101(44):15688-93. Epub 2004 Oct 26.
30.
1.5 kb mRNA abundantly expressed in rat tumors encodes a 37 kilodalton protein in vitro.
Maehara Y, etal., Biochem Biophys Res Commun 1985 Sep 16;131(2):800-5.
31.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
32.
Disruption of GluR2/GAPDH Complex Interaction by TAT-GluR2NT1-3-2 Peptide Protects against Neuronal Death Induced by Epilepsy.
Mi Q, etal., Ann Clin Lab Sci. 2018 Jul;48(4):460-468.
33.
Nuclear-translocated Glyceraldehyde-3-phosphate Dehydrogenase Promotes Poly(ADP-ribose) Polymerase-1 Activation during Oxidative/Nitrosative Stress in Stroke.
Nakajima H, etal., J Biol Chem. 2015 Jun 5;290(23):14493-503. doi: 10.1074/jbc.M114.635607. Epub 2015 Apr 16.
34.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
35.
An increase in S-glutathionylated proteins in the Alzheimer's disease inferior parietal lobule, a proteomics approach.
Newman SF, etal., J Neurosci Res. 2007 May 15;85(7):1506-14. doi: 10.1002/jnr.21275.
36.
Molecular and functional characterization of ERG, KCNQ, and KCNE subtypes in rat stomach smooth muscle.
Ohya S, etal., Am J Physiol Gastrointest Liver Physiol 2002 Feb;282(2):G277-87.
37.
Identification of reliable reference genes for quantitative gene expression studies in oral squamous cell carcinomas compared to adjacent normal tissues in the F344 rat model.
Peng X and McCormick DL, Oncol Rep. 2016 Aug;36(2):1076-84. doi: 10.3892/or.2016.4883. Epub 2016 Jun 16.
38.
Post-transcriptional regulation of glyceraldehyde-3-phosphate-dehydrogenase gene expression in rat tissues.
Piechaczyk M, etal., Nucleic Acids Res 1984 Sep 25;12(18):6951-63.
39.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
40.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
41.
Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) Protein-Protein Interaction Inhibitor Reveals a Non-catalytic Role for GAPDH Oligomerization in Cell Death.
Qvit N, etal., J Biol Chem. 2016 Jun 24;291(26):13608-21. doi: 10.1074/jbc.M115.711630. Epub 2016 Apr 27.
42.
Response of rat cerebral glycolytic enzymes to hyperammonemic states.
Ratnakumari L and Murthy CR, Neurosci Lett. 1993 Oct 14;161(1):37-40.
43.
GOA pipeline
RGD automated data pipeline
44.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
45.
Monochloroacetic acid inhibits liver gluconeogenesis by inactivating glyceraldehyde-3-phosphate dehydrogenase.
Sakai A, etal., Chem Res Toxicol. 2005 Feb;18(2):277-82.
46.
GOSPEL: a neuroprotective protein that binds to GAPDH upon S-nitrosylation.
Sen N, etal., Neuron. 2009 Jul 16;63(1):81-91. doi: 10.1016/j.neuron.2009.05.024.
47.
Proteomics profiling of nuclear proteins for kidney fibroblasts suggests hypoxia, meiosis, and cancer may meet in the nucleus.
Shakib K, etal., Proteomics. 2005 Jul;5(11):2819-38.
48.
Decrease of dehydrogenase activity of cerebral glyceraldehyde-3-phosphate dehydrogenase in different animal models of Alzheimer's disease.
Shalova IN, etal., Biochim Biophys Acta. 2007 May;1770(5):826-32. doi: 10.1016/j.bbagen.2007.01.014. Epub 2007 Feb 4.
49.
Enhanced anti-obesity effects of complex of resistant starch and chitosan in high fat diet fed rats.
Si X, etal., Carbohydr Polym. 2017 Feb 10;157:834-841. doi: 10.1016/j.carbpol.2016.10.042. Epub 2016 Oct 17.
50.
Effects of acute ethanol exposure on regulatory mechanisms of Bcl-2-associated apoptosis promoter, bad, in neonatal rat cerebellum: differential effects during vulnerable and resistant developmental periods.
Siler-Marsiglio KI, etal., Alcohol Clin Exp Res. 2006 Jun;30(6):1031-8. doi: 10.1111/j.1530-0277.2006.000126.x.
51.
HIF-1a and PPAR¿ during physiological cardiac hypertrophy induced by pregnancy: Transcriptional activities and effects on target genes.
Soñanez-Organis JG, etal., Gene. 2016 Oct 15;591(2):376-81. doi: 10.1016/j.gene.2016.06.025. Epub 2016 Jun 14.
52.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
53.
Glyceraldehyde 3-phosphate dehydrogenase is required for band 3 (anion exchanger 1) membrane residency in the mammalian kidney.
Su Y, etal., Am J Physiol Renal Physiol. 2011 Jan;300(1):F157-66. doi: 10.1152/ajprenal.00228.2010. Epub 2010 Oct 27.
54.
Over-expression of GAPDH induces apoptosis in COS-7 cells transfected with cloned GAPDH cDNAs.
Tajima H, etal., Neuroreport 1999 Jul 13;10(10):2029-33.
55.
Thyroid hormone treatment decreases hepatic glucose production and renal reabsorption of glucose in alloxan-induced diabetic Wistar rats.
Teixeira SD, etal., Physiol Rep. 2016 Sep;4(18). pii: 4/18/e12961. doi: 10.14814/phy2.12961.
56.
Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene.
Tso JY, etal., Nucleic Acids Res 1985 Apr 11;13(7):2485-502.
57.
Maternal diabetes in vivo and high glucose in vitro diminish GAPDH activity in rat embryos.
Wentzel P, etal., Diabetes. 2003 May;52(5):1222-8.
58.
The synthesis of ATP by glycolytic enzymes in the postsynaptic density and the effect of endogenously generated nitric oxide.
Wu K, etal., Proc Natl Acad Sci U S A. 1997 Nov 25;94(24):13273-8.
59.
Ethanol impairs insulin-stimulated neuronal survival in the developing brain: role of PTEN phosphatase.
Xu J, etal., J Biol Chem. 2003 Jul 18;278(29):26929-37. Epub 2003 Apr 16.
Gapdh Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 159,648,592 - 159,653,436 (-) NCBI GRCr8 mRatBN7.2 4 157,962,312 - 157,967,158 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 157,962,343 - 157,966,235 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 4 157,676,336 - 157,680,322 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_5.0 4 224,693,580 - 224,697,455 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 161,282,215 - 161,286,090 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 146,699,388 - 146,703,263 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
GAPDH Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 6,534,517 - 6,538,371 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 6,534,512 - 6,538,374 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 6,643,683 - 6,647,537 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 6,513,918 - 6,517,797 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 6,513,944 - 6,517,797 NCBI Celera 12 8,260,518 - 8,264,397 (+) NCBI Celera Cytogenetic Map 12 p13.31 NCBI HuRef 12 6,497,829 - 6,501,781 (+) NCBI HuRef CHM1_1 12 6,642,592 - 6,646,544 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 6,544,873 - 6,548,727 (+) NCBI T2T-CHM13v2.0
Gapdh Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 125,138,812 - 125,143,450 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 125,138,678 - 125,143,430 (-) Ensembl GRCm39 Ensembl GRCm38 6 125,161,852 - 125,166,467 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 125,161,715 - 125,166,467 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 125,111,870 - 125,115,601 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 125,128,554 - 125,131,222 (-) NCBI MGSCv36 mm8 Celera 6 126,831,711 - 126,835,442 (-) NCBI Celera Cytogenetic Map 6 F2 NCBI cM Map 6 59.32 NCBI
Gapdh Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 4,162,467 - 4,166,783 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 4,162,467 - 4,166,783 (+) NCBI ChiLan1.0 ChiLan1.0
GAPDH Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 12,096,075 - 12,100,140 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 12,092,832 - 12,096,897 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 6,665,218 - 6,669,170 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 6,583,895 - 6,587,729 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 6,583,895 - 6,587,729 (+) Ensembl panpan1.1 panPan2
LOC100688969 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 X 51,925,654 - 51,926,724 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha X 42,758,798 - 42,759,848 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 X 52,892,500 - 52,893,549 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 X 50,867,280 - 50,868,330 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 X 52,198,694 - 52,199,710 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 X 52,119,573 - 52,120,589 (+) NCBI UU_Cfam_GSD_1.0
Gapdh Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 102,575,598 - 102,580,238 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936709 1,243,147 - 1,247,903 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936709 1,243,149 - 1,247,782 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
GAPDH Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 64,129,679 - 64,133,991 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 64,129,678 - 64,135,194 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 66,446,302 - 66,449,510 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap 5 q12-q21 NCBI
GAPDH
Gapdh
.
Predicted Target Of
Count of predictions: 56 Count of miRNA genes: 48 Interacting mature miRNAs: 52 Transcripts: ENSRNOT00000050443 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1581574 Eae20 Experimental allergic encephalomyelitis QTL 20 7.8 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 153031106 158841762 Rat 1300109 Rf13 Renal function QTL 13 3.91 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 4 157710145 182687754 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1581566 Eae21 Experimental allergic encephalomyelitis QTL 21 6.2 body mass (VT:0001259) maximum body weight loss to initial body weight ratio (CMO:0001400) 4 157680158 158841762 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
PMC122612P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 3 q21 UniSTS Cytogenetic Map 10 q26 UniSTS Cytogenetic Map 18 q12.1 UniSTS
PMC128021P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 18 q12.1 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 10 q32.1 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 3 q21 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 10 q26 UniSTS Cytogenetic Map 5 q24 UniSTS Cytogenetic Map 6 q32 UniSTS
PMC133764P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q22 UniSTS Cytogenetic Map 9 q13 UniSTS Cytogenetic Map 16 q11 UniSTS Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 2 q34 UniSTS Cytogenetic Map 10 q26 UniSTS Cytogenetic Map 16 p14 UniSTS Cytogenetic Map 18 q12.1 UniSTS
PMC15575P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 18 q12.1 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 10 q32.1 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 2 q42 UniSTS Cytogenetic Map 11 q22 UniSTS
PMC164515P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 10 q32.1 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 3 q21 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 6 q32 UniSTS
PMC186377P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 8 q22 UniSTS
PMC26839P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 16 q11 UniSTS Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 15 q21 UniSTS Cytogenetic Map 16 p14 UniSTS Cytogenetic Map 18 q12.1 UniSTS
PMC316856P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 16 q11 UniSTS Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 10 q32.1 UniSTS Cytogenetic Map 16 p14 UniSTS Cytogenetic Map 18 q12.1 UniSTS
PMC327192P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 16 p14 UniSTS Cytogenetic Map 19 p11 UniSTS
PMC329392P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 18 q12.1 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 3 q21 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 15 q21 UniSTS Cytogenetic Map 2 q42 UniSTS Cytogenetic Map 10 q32.1 UniSTS
PMC128235P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 8 q22 UniSTS Cytogenetic Map 18 q12.1 UniSTS Cytogenetic Map 11 q22 UniSTS Cytogenetic Map 10 q32.1 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 13 q22 UniSTS Cytogenetic Map 19 p11 UniSTS Cytogenetic Map 15 q21 UniSTS Cytogenetic Map 7 q13 UniSTS Cytogenetic Map 2 q42 UniSTS Cytogenetic Map 3 q21 UniSTS
RH140227
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 157,961,933 - 157,962,127 (+) MAPPER mRatBN7.2 Rnor_6.0 4 157,675,972 - 157,676,165 NCBI Rnor6.0 Rnor_5.0 4 224,693,156 - 224,693,349 UniSTS Rnor5.0 RGSC_v3.4 4 161,281,791 - 161,281,984 UniSTS RGSC3.4 Celera 4 146,698,964 - 146,699,157 UniSTS RH 3.4 Map 4 1005.8 UniSTS Cytogenetic Map 4 q42 UniSTS
PMC193571P1
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q33 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 10 q32.1 UniSTS
PMC104479P2
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 X 55,897,275 - 55,897,778 NCBI Rnor5.0 Rnor_5.0 1 207,898,087 - 207,898,589 NCBI Rnor5.0 Rnor_5.0 1 208,042,287 - 208,042,789 NCBI Rnor5.0 RGSC_v3.4 X 93,852,831 - 93,853,333 UniSTS RGSC3.4 RGSC_v3.4 1 189,771,940 - 189,772,441 UniSTS RGSC3.4 Celera X 72,115,994 - 72,116,496 UniSTS Celera 1 182,631,486 - 182,631,987 UniSTS Cytogenetic Map X q31 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 1 q37 UniSTS
PMC112827P1
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 X 55,897,275 - 55,897,396 NCBI Rnor5.0 Rnor_5.0 1 207,898,087 - 207,898,207 NCBI Rnor5.0 Rnor_5.0 1 208,042,287 - 208,042,407 NCBI Rnor5.0 RGSC_v3.4 X 93,852,831 - 93,852,951 UniSTS RGSC3.4 RGSC_v3.4 1 189,771,940 - 189,772,059 UniSTS RGSC3.4 Celera X 72,115,994 - 72,116,114 UniSTS Celera 1 182,631,486 - 182,631,605 UniSTS Cytogenetic Map X q31 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 1 q37 UniSTS
PMC115884P2
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 X 55,897,276 - 55,897,582 NCBI Rnor5.0 Rnor_5.0 1 207,898,088 - 207,898,393 NCBI Rnor5.0 Rnor_5.0 1 208,042,288 - 208,042,593 NCBI Rnor5.0 RGSC_v3.4 X 93,852,832 - 93,853,137 UniSTS RGSC3.4 RGSC_v3.4 1 189,771,941 - 189,772,245 UniSTS RGSC3.4 Celera X 72,115,995 - 72,116,300 UniSTS Celera 1 182,631,487 - 182,631,791 UniSTS Cytogenetic Map X q31 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 1 q37 UniSTS
PMC21468P1
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 X 55,897,276 - 55,897,638 NCBI Rnor5.0 Rnor_5.0 1 207,898,088 - 207,898,449 NCBI Rnor5.0 Rnor_5.0 1 208,042,288 - 208,042,649 NCBI Rnor5.0 RGSC_v3.4 X 93,852,832 - 93,853,193 UniSTS RGSC3.4 RGSC_v3.4 1 189,771,941 - 189,772,301 UniSTS RGSC3.4 Celera X 72,115,995 - 72,116,356 UniSTS Celera 1 182,631,487 - 182,631,847 UniSTS Cytogenetic Map X q31 UniSTS Cytogenetic Map 4 q42 UniSTS Cytogenetic Map 1 q37 UniSTS
PMC266773P1
Rat Assembly Chr Position (strand) Source JBrowse Rnor_5.0 1 207,898,088 - 207,898,449 NCBI Rnor5.0 Rnor_5.0 X 55,897,276 - 55,897,638 NCBI Rnor5.0 Rnor_5.0 1 208,042,288 - 208,042,649 NCBI Rnor5.0 RGSC_v3.4 1 189,771,941 - 189,772,301 UniSTS RGSC3.4 RGSC_v3.4 X 93,852,832 - 93,853,193 UniSTS RGSC3.4 Celera 1 182,631,487 - 182,631,847 UniSTS Celera X 72,115,995 - 72,116,356 UniSTS Cytogenetic Map 1 q37 UniSTS Cytogenetic Map X q31 UniSTS Cytogenetic Map 4 q42 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
3
11
43
82
57
60
41
19
41
160
73
74
35
41
19
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000050443 ⟹ ENSRNOP00000040878
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 157,962,361 - 157,966,235 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000110793 ⟹ ENSRNOP00000084281
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 157,962,343 - 157,966,174 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000114924 ⟹ ENSRNOP00000088495
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 157,962,356 - 157,965,978 (-) Ensembl
RefSeq Acc Id:
NM_017008 ⟹ NP_058704
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,648,592 - 159,652,467 (-) NCBI mRatBN7.2 4 157,962,358 - 157,966,233 (-) NCBI Rnor_6.0 4 157,676,396 - 157,680,271 (-) NCBI Rnor_5.0 4 224,693,580 - 224,697,455 (-) NCBI RGSC_v3.4 4 161,282,215 - 161,286,090 (-) RGD Celera 4 146,699,388 - 146,703,263 (-) RGD
Sequence:
GGGGCTCTCTGCTCCTCCCTGTTCTAGAGACAGCCGCATCTTCTTGTGCAGTGCCAGCCTCGTCTCATAGACAAGATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATCGGACGCCTGGTTACCAG
hide sequence
RefSeq Acc Id:
XM_039107008 ⟹ XP_038962936
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,648,592 - 159,653,436 (-) NCBI mRatBN7.2 4 157,962,312 - 157,967,158 (-) NCBI
RefSeq Acc Id:
XM_063285517 ⟹ XP_063141587
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,648,592 - 159,652,464 (-) NCBI
RefSeq Acc Id:
XM_063285518 ⟹ XP_063141588
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,648,592 - 159,652,060 (-) NCBI
RefSeq Acc Id:
XM_063285519 ⟹ XP_063141589
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,648,592 - 159,652,459 (-) NCBI
RefSeq Acc Id:
NP_058704 ⟸ NM_017008
- UniProtKB:
Q5M916 (UniProtKB/Swiss-Prot), P09328 (UniProtKB/Swiss-Prot), Q9QWU4 (UniProtKB/Swiss-Prot), P04797 (UniProtKB/Swiss-Prot), A6ILS6 (UniProtKB/TrEMBL), A0A8L2QM97 (UniProtKB/TrEMBL)
- Sequence:
MVKVGVNGFGRIGRLVTRAAFSCDKVDIVAINDPFIDLNYMVYMFQYDSTHGKFNGTVKAENGKLVINGKPITIFQERDPANIKWGDAGAEYVVESTGVFTTMEKAGAHLKGGAKRVIISAPSADAPM
hide sequence
RefSeq Acc Id:
XP_038962936 ⟸ XM_039107008
- Peptide Label:
isoform X1
- UniProtKB:
Q5M916 (UniProtKB/Swiss-Prot), P09328 (UniProtKB/Swiss-Prot), P04797 (UniProtKB/Swiss-Prot), Q9QWU4 (UniProtKB/Swiss-Prot), A6ILS6 (UniProtKB/TrEMBL), A0A8L2QM97 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000040878 ⟸ ENSRNOT00000050443
Ensembl Acc Id:
ENSRNOP00000084281 ⟸ ENSRNOT00000110793
Ensembl Acc Id:
ENSRNOP00000088495 ⟸ ENSRNOT00000114924
RefSeq Acc Id:
XP_063141587 ⟸ XM_063285517
- Peptide Label:
isoform X2
- UniProtKB:
A0A8L2QM97 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141589 ⟸ XM_063285519
- Peptide Label:
isoform X3
- UniProtKB:
E9PTV9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141588 ⟸ XM_063285518
- Peptide Label:
isoform X3
- UniProtKB:
E9PTV9 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2006-02-01
Gapdh
Gapd
glyceraldehyde-3-phosphate dehydrogenase
Symbol updated to reflect Human and Mouse nomenclature
1299863 APPROVED
2002-06-10
Gapd
Glyceraldehyde-3-phosphate dehydrogenase
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
expressed in atria and ventricles of the heart
625420
gene_expression
expressed in all tissues
632774
gene_protein
333 amino acids
632774
