Symbol:
Pik3r5
Name:
phosphoinositide-3-kinase, regulatory subunit 5
RGD ID:
1563261
Description:
Enables 1-phosphatidylinositol-3-kinase regulator activity. Involved in phosphatidylinositol metabolic process. Part of phosphatidylinositol 3-kinase complex. Human ortholog(s) of this gene implicated in ataxia with oculomotor apraxia type 3 and colon cancer. Orthologous to human PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5); PARTICIPATES IN eicosanoid signaling pathway; ephrin - ephrin receptor bidirectional signaling axis; phosphatidylinositol 3-kinase class I signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; acetamide; alpha-Zearalanol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC497931; phosphoinositide 3-kinase regulatory subunit 5; phosphoinositide-3-kinase, regulatory subunit 5, p101; RGD1563261; similar to novel protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Pik3r5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pik3r5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pik3r5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pik3r5 (phosphoinositide-3-kinase regulatory subunit 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Pik3r5 (phosphoinositide-3-kinase regulatory subunit 5)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pik3r5 (phosphoinositide-3-kinase, regulatory subunit 5)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
pik3r5
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 53,631,469 - 53,699,550 (+) NCBI GRCr8 mRatBN7.2 10 53,132,585 - 53,200,663 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 53,132,603 - 53,199,374 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 57,838,940 - 57,859,341 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 57,327,976 - 57,348,381 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 52,836,777 - 52,857,177 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 55,013,686 - 55,078,986 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 55,013,703 - 55,080,421 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 54,757,809 - 54,822,968 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 55,227,872 - 55,248,301 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 52,347,081 - 52,367,505 (+) NCBI Celera Cytogenetic Map 10 q24 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pik3r5 Rat 1,2-dichloroethane decreases expression ISO Pik3r5 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of PIK3R5 mRNA CTD PMID:28960355 Pik3r5 Rat 1,2-dimethylhydrazine increases expression ISO Pik3r5 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of PIK3R5 mRNA CTD PMID:22206623 Pik3r5 Rat 2,2',4,4'-Tetrabromodiphenyl ether multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [Flame Retardants results in increased abundance of 2 more ... CTD PMID:38995820 Pik3r5 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Pik3r5 (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to PIK3R5 gene] CTD PMID:20819909 Pik3r5 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of PIK3R5 mRNA CTD PMID:33387578 Pik3r5 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of PIK3R5 mRNA CTD PMID:34747641 Pik3r5 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Pik3r5 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of PIK3R5 mRNA CTD PMID:28922406 Pik3r5 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Pik3r5 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of PIK3R5 mRNA CTD PMID:20819909 Pik3r5 Rat 2,6-di-tert-butyl-4-methylphenol increases expression ISO Pik3r5 (Mus musculus) 6480464 Butylated Hydroxytoluene results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO Pik3r5 (Mus musculus) 6480464 tetrabromobisphenol A results in increased expression of PIK3R5 mRNA CTD PMID:25172293 Pik3r5 Rat 3-methylcholanthrene increases expression ISO Pik3r5 (Mus musculus) 6480464 Methylcholanthrene results in increased expression of PIK3R5 mRNA CTD PMID:20713471 Pik3r5 Rat 7,12-dimethyltetraphene increases expression ISO Pik3r5 (Mus musculus) 6480464 9 more ... CTD PMID:20025956 Pik3r5 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of PIK3R5 mRNA CTD PMID:31881176 Pik3r5 Rat acrylamide increases expression ISO Pik3r5 (Mus musculus) 6480464 Acrylamide results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat aflatoxin B1 decreases methylation ISO PIK3R5 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of PIK3R5 intron CTD PMID:30157460 Pik3r5 Rat Aflatoxin B2 alpha increases methylation ISO PIK3R5 (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of PIK3R5 intron CTD PMID:30157460 Pik3r5 Rat all-trans-retinoic acid increases expression ISO Pik3r5 (Mus musculus) 6480464 Tretinoin results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat all-trans-retinoic acid increases expression ISO PIK3R5 (Homo sapiens) 6480464 Tretinoin results in increased expression of PIK3R5 mRNA CTD PMID:33167477 Pik3r5 Rat alpha-Zearalanol increases expression EXP 6480464 Zeranol results in increased expression of PIK3R5 mRNA CTD PMID:35163327 Pik3r5 Rat anthracene-1,8,9-triol increases expression ISO Pik3r5 (Mus musculus) 6480464 Anthralin results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat antirheumatic drug decreases expression ISO PIK3R5 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of PIK3R5 mRNA CTD PMID:24449571 Pik3r5 Rat arsenite(3-) decreases expression ISO Pik3r5 (Mus musculus) 6480464 arsenite results in decreased expression of PIK3R5 mRNA CTD PMID:18191166 Pik3r5 Rat benzene increases expression ISO PIK3R5 (Homo sapiens) 6480464 Benzene results in increased expression of PIK3R5 mRNA CTD PMID:15929907 Pik3r5 Rat benzo[a]pyrene increases expression ISO PIK3R5 (Homo sapiens) 6480464 Benzo(a)pyrene metabolite results in increased expression of PIK3R5 mRNA CTD PMID:26314263 Pik3r5 Rat benzo[a]pyrene affects methylation ISO PIK3R5 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PIK3R5 5' UTR and Benzo(a)pyrene affects the methylation of PIK3R5 intron CTD PMID:27901495 and PMID:30157460 Pik3r5 Rat benzo[a]pyrene increases methylation ISO PIK3R5 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of PIK3R5 promoter CTD PMID:27901495 Pik3r5 Rat benzo[e]pyrene increases methylation ISO PIK3R5 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of PIK3R5 intron CTD PMID:30157460 Pik3r5 Rat beta-carotene increases expression ISO Pik3r5 (Mus musculus) 6480464 beta Carotene results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat bis(2-chloroethyl) sulfide increases expression ISO Pik3r5 (Mus musculus) 6480464 Mustard Gas results in increased expression of PIK3R5 mRNA CTD PMID:18955075 Pik3r5 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PIK3R5 mRNA CTD PMID:25181051 and PMID:34947998 Pik3r5 Rat bisphenol A increases expression ISO Pik3r5 (Mus musculus) 6480464 bisphenol A results in increased expression of PIK3R5 mRNA CTD PMID:38701888 Pik3r5 Rat bisphenol A decreases methylation ISO PIK3R5 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of PIK3R5 gene CTD PMID:31601247 Pik3r5 Rat butylated hydroxyanisole increases expression ISO Pik3r5 (Mus musculus) 6480464 Butylated Hydroxyanisole results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat calcitriol decreases expression ISO PIK3R5 (Homo sapiens) 6480464 Calcitriol results in decreased expression of PIK3R5 mRNA CTD PMID:26485663 Pik3r5 Rat carbon nanotube increases expression ISO Pik3r5 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Pik3r5 Rat CGP 52608 multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to PIK3R5 gene] CTD PMID:28238834 Pik3r5 Rat cholic acid increases expression ISO Pik3r5 (Mus musculus) 6480464 Cholic Acid results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat choline multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PIK3R5 mRNA CTD PMID:20938992 Pik3r5 Rat clofibrate increases expression ISO Pik3r5 (Mus musculus) 6480464 Clofibrate results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat copper atom multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [Organoselenium Compounds binds to Copper] which results in increased expression of PIK3R5 mRNA CTD PMID:25167922 Pik3r5 Rat copper(0) multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [Organoselenium Compounds binds to Copper] which results in increased expression of PIK3R5 mRNA CTD PMID:25167922 Pik3r5 Rat Cuprizon affects expression EXP 6480464 Cuprizone affects the expression of PIK3R5 mRNA CTD PMID:27523638 Pik3r5 Rat dextran sulfate increases expression ISO Pik3r5 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat Dibutyl phosphate affects expression ISO PIK3R5 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of PIK3R5 mRNA CTD PMID:37042841 Pik3r5 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of PIK3R5 mRNA CTD PMID:33729688 Pik3r5 Rat dorsomorphin multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Pik3r5 Rat entinostat increases expression ISO PIK3R5 (Homo sapiens) 6480464 entinostat results in increased expression of PIK3R5 mRNA CTD PMID:26272509 Pik3r5 Rat folic acid multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PIK3R5 mRNA CTD PMID:20938992 Pik3r5 Rat fulvestrant decreases methylation ISO PIK3R5 (Homo sapiens) 6480464 Fulvestrant results in decreased methylation of PIK3R5 gene CTD PMID:31601247 Pik3r5 Rat glyphosate increases expression EXP 6480464 Glyphosate results in increased expression of PIK3R5 mRNA CTD PMID:38314887 Pik3r5 Rat iron dichloride increases expression ISO Pik3r5 (Mus musculus) 6480464 ferrous chloride results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat iron trichloride increases expression ISO Pik3r5 (Mus musculus) 6480464 ferric chloride results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat L-methionine multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of PIK3R5 mRNA CTD PMID:20938992 Pik3r5 Rat lipopolysaccharide increases expression ISO Pik3r5 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of PIK3R5 mRNA CTD PMID:25890327 Pik3r5 Rat lithocholic acid increases expression ISO Pik3r5 (Mus musculus) 6480464 Lithocholic Acid results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat mercury dibromide decreases expression ISO PIK3R5 (Homo sapiens) 6480464 mercuric bromide results in decreased expression of PIK3R5 mRNA CTD PMID:26272509 Pik3r5 Rat mercury dibromide multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of PIK3R5 mRNA CTD PMID:27188386 Pik3r5 Rat methamphetamine decreases expression EXP 6480464 Methamphetamine results in decreased expression of PIK3R5 mRNA CTD PMID:19564919 Pik3r5 Rat methamphetamine multiple interactions EXP 6480464 [Methamphetamine co-treated with SCH 23390] results in decreased expression of PIK3R5 mRNA CTD PMID:19564919 Pik3r5 Rat methapyrilene increases methylation ISO PIK3R5 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of PIK3R5 intron CTD PMID:30157460 Pik3r5 Rat methyl methanesulfonate decreases expression ISO PIK3R5 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of PIK3R5 mRNA CTD PMID:23649840 Pik3r5 Rat Mezerein increases expression ISO Pik3r5 (Mus musculus) 6480464 mezerein results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat nickel atom increases expression ISO PIK3R5 (Homo sapiens) 6480464 Nickel results in increased expression of PIK3R5 mRNA CTD PMID:25583101 Pik3r5 Rat ochratoxin A decreases expression ISO PIK3R5 (Homo sapiens) 6480464 ochratoxin A metabolite results in decreased expression of PIK3R5 mRNA and ochratoxin A results in decreased expression of PIK3R5 mRNA CTD PMID:26314263 Pik3r5 Rat okadaic acid increases expression ISO Pik3r5 (Mus musculus) 6480464 Okadaic Acid results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat organoselenium compound multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [Organoselenium Compounds binds to Copper] which results in increased expression of PIK3R5 mRNA CTD PMID:25167922 Pik3r5 Rat oxybenzone decreases expression ISO Pik3r5 (Mus musculus) 6480464 oxybenzone results in decreased expression of PIK3R5 mRNA CTD PMID:39343157 Pik3r5 Rat ozone multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of PIK3R5 mRNA CTD PMID:34911549 Pik3r5 Rat ozone multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of PIK3R5 mRNA CTD PMID:35430440 Pik3r5 Rat palytoxin increases expression ISO Pik3r5 (Mus musculus) 6480464 palytoxin results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat paracetamol increases expression ISO Pik3r5 (Mus musculus) 6480464 Acetaminophen results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of PIK3R5 mRNA CTD PMID:33387578 Pik3r5 Rat phenobarbital increases expression ISO Pik3r5 (Mus musculus) 6480464 Phenobarbital results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat phenylmercury acetate decreases expression ISO PIK3R5 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of PIK3R5 mRNA CTD PMID:26272509 Pik3r5 Rat phenylmercury acetate multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of PIK3R5 mRNA CTD PMID:27188386 Pik3r5 Rat phorbol 13-acetate 12-myristate increases expression ISO Pik3r5 (Mus musculus) 6480464 Tetradecanoylphorbol Acetate results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat pirinixic acid decreases expression ISO Pik3r5 (Mus musculus) 6480464 pirinixic acid results in decreased expression of PIK3R5 mRNA CTD PMID:20813756 Pik3r5 Rat pirinixic acid multiple interactions ISO Pik3r5 (Mus musculus) 6480464 [pirinixic acid co-treated with PPARA] results in decreased expression of PIK3R5 mRNA CTD PMID:20813756 Pik3r5 Rat propanal decreases expression ISO PIK3R5 (Homo sapiens) 6480464 propionaldehyde results in decreased expression of PIK3R5 mRNA CTD PMID:26079696 Pik3r5 Rat propionic acid increases expression ISO Pik3r5 (Mus musculus) 6480464 propionic acid results in increased expression of PIK3R5 protein CTD PMID:20025956 Pik3r5 Rat saccharin increases expression ISO Pik3r5 (Mus musculus) 6480464 Saccharin results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat SB 431542 multiple interactions ISO PIK3R5 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Pik3r5 Rat SCH 23390 multiple interactions EXP 6480464 [Methamphetamine co-treated with SCH 23390] results in decreased expression of PIK3R5 mRNA CTD PMID:19564919 Pik3r5 Rat serpentine asbestos increases expression ISO PIK3R5 (Homo sapiens) 6480464 Asbestos and Serpentine results in increased expression of PIK3R5 mRNA CTD PMID:21148743 Pik3r5 Rat silicon dioxide increases expression ISO Pik3r5 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of PIK3R5 mRNA CTD PMID:29341224 Pik3r5 Rat sodium arsenate increases expression ISO Pik3r5 (Mus musculus) 6480464 sodium arsenate results in increased expression of PIK3R5 mRNA CTD PMID:20667999 Pik3r5 Rat sodium arsenate affects methylation ISO Pik3r5 (Mus musculus) 6480464 sodium arsenate affects the methylation of PIK3R5 promoter CTD PMID:20667999 Pik3r5 Rat sulfadimethoxine increases expression ISO Pik3r5 (Mus musculus) 6480464 Sulfadimethoxine results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat testosterone decreases expression ISO PIK3R5 (Homo sapiens) 6480464 Testosterone results in decreased expression of PIK3R5 mRNA CTD PMID:33359661 Pik3r5 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of PIK3R5 mRNA CTD PMID:34492290 Pik3r5 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of PIK3R5 mRNA CTD PMID:33387578 Pik3r5 Rat triphenyl phosphate affects expression ISO PIK3R5 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of PIK3R5 mRNA CTD PMID:37042841 Pik3r5 Rat triptonide increases expression ISO Pik3r5 (Mus musculus) 6480464 triptonide results in increased expression of PIK3R5 mRNA CTD PMID:33045310 Pik3r5 Rat tungsten decreases expression ISO Pik3r5 (Mus musculus) 6480464 Tungsten results in decreased expression of PIK3R5 mRNA CTD PMID:30912803 Pik3r5 Rat valproic acid increases expression ISO PIK3R5 (Homo sapiens) 6480464 Valproic Acid results in increased expression of PIK3R5 mRNA CTD PMID:24383497 and PMID:28001369 Pik3r5 Rat valproic acid decreases methylation ISO PIK3R5 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of PIK3R5 gene CTD PMID:29154799 Pik3r5 Rat zinc atom increases expression ISO PIK3R5 (Homo sapiens) 6480464 Zinc results in increased expression of PIK3R5 mRNA CTD PMID:19071009 Pik3r5 Rat zinc dichloride increases expression ISO Pik3r5 (Mus musculus) 6480464 zinc chloride results in increased expression of PIK3R5 mRNA CTD PMID:19000923 Pik3r5 Rat zinc(0) increases expression ISO PIK3R5 (Homo sapiens) 6480464 Zinc results in increased expression of PIK3R5 mRNA CTD PMID:19071009
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-di-tert-butyl-4-methylphenol (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-methylcholanthrene (ISO) 7,12-dimethyltetraphene (ISO) acetamide (EXP) acrylamide (ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (EXP) anthracene-1,8,9-triol (ISO) antirheumatic drug (ISO) arsenite(3-) (ISO) benzene (ISO) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) beta-carotene (ISO) bis(2-chloroethyl) sulfide (ISO) bisphenol A (EXP,ISO) butylated hydroxyanisole (ISO) calcitriol (ISO) carbon nanotube (ISO) CGP 52608 (ISO) cholic acid (ISO) choline (ISO) clofibrate (ISO) copper atom (ISO) copper(0) (ISO) Cuprizon (EXP) dextran sulfate (ISO) Dibutyl phosphate (ISO) dioxygen (EXP) dorsomorphin (ISO) entinostat (ISO) folic acid (ISO) fulvestrant (ISO) glyphosate (EXP) iron dichloride (ISO) iron trichloride (ISO) L-methionine (ISO) lipopolysaccharide (ISO) lithocholic acid (ISO) mercury dibromide (ISO) methamphetamine (EXP) methapyrilene (ISO) methyl methanesulfonate (ISO) Mezerein (ISO) nickel atom (ISO) ochratoxin A (ISO) okadaic acid (ISO) organoselenium compound (ISO) oxybenzone (ISO) ozone (ISO) palytoxin (ISO) paracetamol (EXP,ISO) phenobarbital (ISO) phenylmercury acetate (ISO) phorbol 13-acetate 12-myristate (ISO) pirinixic acid (ISO) propanal (ISO) propionic acid (ISO) saccharin (ISO) SB 431542 (ISO) SCH 23390 (EXP) serpentine asbestos (ISO) silicon dioxide (ISO) sodium arsenate (ISO) sulfadimethoxine (ISO) testosterone (ISO) thioacetamide (EXP) trichloroethene (EXP) triphenyl phosphate (ISO) triptonide (ISO) tungsten (ISO) valproic acid (ISO) zinc atom (ISO) zinc dichloride (ISO) zinc(0) (ISO)
Pik3r5 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 53,631,469 - 53,699,550 (+) NCBI GRCr8 mRatBN7.2 10 53,132,585 - 53,200,663 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 53,132,603 - 53,199,374 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 57,838,940 - 57,859,341 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 57,327,976 - 57,348,381 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 52,836,777 - 52,857,177 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 55,013,686 - 55,078,986 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 55,013,703 - 55,080,421 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 54,757,809 - 54,822,968 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 55,227,872 - 55,248,301 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 52,347,081 - 52,367,505 (+) NCBI Celera Cytogenetic Map 10 q24 NCBI
PIK3R5 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 8,878,916 - 8,965,707 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 8,878,911 - 8,965,712 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 8,782,233 - 8,869,024 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 8,724,138 - 8,756,559 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 8,724,137 - 8,756,559 NCBI Celera 17 8,814,067 - 8,900,857 (-) NCBI Celera Cytogenetic Map 17 p13.1 NCBI HuRef 17 8,681,483 - 8,768,185 (-) NCBI HuRef CHM1_1 17 8,791,349 - 8,878,194 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 8,786,072 - 8,872,872 (-) NCBI T2T-CHM13v2.0
Pik3r5 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 68,322,951 - 68,388,675 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 68,322,947 - 68,388,675 (+) Ensembl GRCm39 Ensembl GRCm38 11 68,432,125 - 68,497,849 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 68,432,121 - 68,497,849 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 68,245,627 - 68,311,348 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 68,248,320 - 68,314,041 (+) NCBI MGSCv36 mm8 Celera 11 75,369,339 - 75,435,134 (+) NCBI Celera Cytogenetic Map 11 B3 NCBI cM Map 11 41.69 NCBI
Pik3r5 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955467 8,065,857 - 8,091,486 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955467 8,025,231 - 8,091,406 (+) NCBI ChiLan1.0 ChiLan1.0
PIK3R5 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 64,780,309 - 64,868,388 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 69,590,055 - 69,677,728 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 42,686,483 - 42,773,668 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 47,421,204 - 47,507,282 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 47,475,201 - 47,507,282 (+) Ensembl panpan1.1 panPan2
PIK3R5 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 33,538,354 - 33,604,984 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 33,532,708 - 33,604,984 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 33,674,664 - 33,741,285 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 33,641,537 - 33,708,256 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 33,635,875 - 33,708,207 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 33,609,183 - 33,675,765 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 33,566,733 - 33,633,509 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 33,743,236 - 33,809,805 (-) NCBI UU_Cfam_GSD_1.0
Pik3r5 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 48,554,342 - 48,581,804 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936595 2,029,814 - 2,055,976 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936595 2,029,074 - 2,053,954 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PIK3R5 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 53,979,207 - 54,054,490 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 53,979,206 - 54,046,927 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 56,731,153 - 56,799,397 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PIK3R5 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 8,235,891 - 8,322,347 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 8,234,962 - 8,322,320 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 13,059,577 - 13,147,349 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pik3r5
.
Predicted Target Of
Count of predictions: 246 Count of miRNA genes: 165 Interacting mature miRNAs: 183 Transcripts: ENSRNOT00000032785 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61441 Btemp1 Thermal response to stress QTL 1 4 body temperature trait (VT:0005535) core body temperature (CMO:0001036) 10 35392457 63642539 Rat 1549846 Scl47 Serum cholesterol level QTL 47 3.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 50574707 95574707 Rat 9589136 Insul27 Insulin level QTL 27 10.46 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 10 11474010 56474010 Rat 152025229 Scl83 Serum cholesterol level QTL 83 4.33 blood cholesterol amount (VT:0000180) 10 35710580 68663659 Rat 1578779 Tcas10 Tongue tumor susceptibility QTL 10 3.12 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 10 31297439 76297439 Rat 152025227 Bw195 Body weight QTL 195 5.73 body mass (VT:0001259) 10 46989699 68663659 Rat 631564 Apr3 Acute phase response QTL 3 3.9 blood interleukin-6 amount (VT:0008595) plasma interleukin-6 level (CMO:0001927) 10 15275955 60275955 Rat 1298069 Bp168 Blood pressure QTL 168 5.5 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 10 26521957 98003205 Rat 2293669 Bmd33 Bone mineral density QTL 33 4.5 0.0001 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 10 49444551 81709989 Rat 152025224 Bw193 Body weight QTL 193 6.47 body mass (VT:0001259) 10 51663405 75085664 Rat 631552 Vetf2 Vascular elastic tissue fragility QTL 2 4.5 0.0002 aorta elastic tissue integrity trait (VT:0010556) artery internal elastic lamina non-tumorous lesion count (CMO:0001913) 10 41142633 86142633 Rat 631554 Bp133 Blood pressure QTL 133 0.005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 743364 63851208 Rat 631557 Bp136 Blood pressure QTL 136 0.003 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 30632053 75632053 Rat 61325 Aia5 Adjuvant induced arthritis QTL 5 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1298078 Stresp5 Stress response QTL 5 2.99 0.00025 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 42045676 104670812 Rat 2293679 Bmd30 Bone mineral density QTL 30 3.5 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 10 49444551 81709989 Rat 1578762 Toxo1 Toxoplasma gondii resistance QTL 1 brain integrity trait (VT:0010579) percentage of study population displaying Toxoplasma gondii brain cysts at a point in time (CMO:0002028) 10 52200030 59378278 Rat 2298544 Neuinf9 Neuroinflammation QTL 9 4.6 nervous system integrity trait (VT:0010566) spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126) 10 5801990 62146030 Rat 61463 Bp12 Blood pressure QTL 12 6.3 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 41333258 86333258 Rat 8694173 Bw149 Body weight QTL 149 4.38 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 10 44441699 89441699 Rat 2300218 Hpcl2 Hepatic cholesterol level QTL 2 liver cholesterol amount (VT:0010498) liver cholesterol level (CMO:0001597) 10 45029650 95600334 Rat 1554317 Bmd4 Bone mineral density QTL 4 9.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 19816042 99406971 Rat 1598852 Anxrr19 Anxiety related response QTL 19 5.07 body movement coordination trait (VT:0005424) number of rearing movements in an experimental apparatus (CMO:0001752) 10 18167841 63167841 Rat 1581497 Esta1 Estrogen-induced thymic atrophy QTL 1 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 10 21329805 61345413 Rat 724527 Bp148 Blood pressure QTL 148 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 28453136 73453136 Rat 1358897 Stresp6 Stress response QTL 6 4.17 0.022 blood norepinephrine amount (VT:0005663) plasma norepinephrine level (CMO:0001010) 10 35392267 64155584 Rat 1331762 Rf40 Renal function QTL 40 3.873 kidney blood vessel physiology trait (VT:0100012) absolute change in renal vascular resistance (CMO:0001900) 10 29299504 64155584 Rat 2300171 Bmd58 Bone mineral density QTL 58 4.9 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 26944628 71944628 Rat 61354 Pia10 Pristane induced arthritis QTL 10 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2301967 Cm73 Cardiac mass QTL 73 4.55 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 10 14487011 89062041 Rat 2303118 Mamtr7 Mammary tumor resistance QTL 7 0.003 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 10 9658275 104670812 Rat 70188 BpQTLcluster1 Blood pressure QTL cluster 1 4.864 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 42323132 87323132 Rat 9590310 Scort19 Serum corticosterone level QTL 19 6.3 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 11474010 56474010 Rat 9589030 Epfw9 Epididymal fat weight QTL 9 19.24 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 10 44441699 89441699 Rat 10402859 Bp381 Blood pressure QTL 381 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 27606468 72606468 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 2293652 Bmd22 Bone mineral density QTL 22 4.9 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 10 49444551 81709989 Rat 70198 BpQTLcluster9 Blood pressure QTL cluster 9 2.94 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 42323132 87323132 Rat 1359017 Hrtrt21 Heart rate QTL 21 2.4 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 10 51772940 96772940 Rat 6893352 Bw100 Body weight QTL 100 0.33 0.6 body mass (VT:0001259) body weight (CMO:0000012) 1 15906665 60906665 Rat 724556 Pur2 Proteinuria QTL 2 5.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 22427500 90627625 Rat 8662860 Vetf10 Vascular elastic tissue fragility QTL 10 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 10 6154182 73453136 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 70223 Bp57 Blood pressure QTL 57 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 1 80676123 Rat 1354587 Kidm21 Kidney mass QTL 21 3.3 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 10 15028513 60430477 Rat 6893350 Bw99 Body weight QTL 99 0.87 0.16 body mass (VT:0001259) body weight (CMO:0000012) 1 15906665 60906665 Rat 2317043 Aia7 Adjuvant induced arthritis QTL 7 3.82 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 37565079 82565079 Rat 70224 Eae3 Experimental allergic encephalomyelitis QTL 3 4.1 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 10 26521957 61345413 Rat 2317042 Aia20 Adjuvant induced arthritis QTL 20 3.38 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 37565079 82565079 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 2313087 Bmd80 Bone mineral density QTL 80 3.2 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 10 19606483 64606483 Rat 70364 Bp72 Blood pressure QTL 72 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 51121100 96121100 Rat 631530 Tls3 T-lymphoma susceptibility QTL 3 0 0.0001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 10 51774612 95600334 Rat 631535 Cm51 Cardiac mass QTL 51 3 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 10 51786282 91669536 Rat 1576319 Cia29 Collagen induced arthritis QTL 29 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 33973921 78973921 Rat 8552805 Bw145 Body weight QTL 145 2.2 body mass (VT:0001259) change in body weight to body weight ratio (CMO:0002216) 10 41944526 78307017 Rat 631267 Cia20 Collagen induced arthritis QTL 20 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2293705 Bmd25 Bone mineral density QTL 25 7.1 0.0001 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 10 49444551 81709989 Rat 1576308 Schws1 Schwannoma susceptibility QTL 1 0.0041 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 40035094 102359817 Rat 631269 Cia22 Collagen induced arthritis QTL 22 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 631268 Cia21 Collagen induced arthritis QTL 21 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 14487011 104060283 Rat 9590268 Scort13 Serum corticosterone level QTL 13 3.26 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 11474010 56474010 Rat 7207811 Bmd90 Bone mineral density QTL 90 5.2 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 10 49444551 81709989 Rat 1576311 Pia26 Pristane induced arthritis QTL 26 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 31224026 75632053 Rat 631270 Cia23 Collagen induced arthritis QTL 23 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 7411614 Foco18 Food consumption QTL 18 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 44441699 89441699 Rat 631547 Bp87 Blood pressure QTL 87 4.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 47369470 92369470 Rat 61427 Cia16 Collagen induced arthritis QTL 16 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 6357896 96121100 Rat 6893342 Cm78 Cardiac mass QTL 78 0.1 0.88 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 10 42876766 79813922 Rat 2292441 Bp308 Blood pressure QTL 308 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 27606468 72606468 Rat 2313055 Bw96 Body weight QTL 96 3.6 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 10 19606483 64606483 Rat 631542 Bp82 Blood pressure QTL 82 6.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 26521957 98952741 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000032785 ⟹ ENSRNOP00000030578
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 53,132,603 - 53,199,374 (+) Ensembl Rnor_6.0 Ensembl 10 55,013,703 - 55,080,421 (+) Ensembl
RefSeq Acc Id:
NM_001191923 ⟹ NP_001178852
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,677,832 - 53,698,261 (+) NCBI mRatBN7.2 10 53,178,944 - 53,199,374 (+) NCBI Rnor_6.0 10 55,058,434 - 55,078,863 (+) NCBI Rnor_5.0 10 54,757,809 - 54,822,968 (+) NCBI Celera 10 52,347,081 - 52,367,505 (+) NCBI
Sequence:
ATGCAGCCAGCAGCCACAACGTGCACAGAGGACCGCATCCAGCACGCTCTGGAGAGATGCTTGCATGGACTGAGCCTCGGACGCCGTTCTGCTCCCTGGTCAGCCGGGCTGTGTCTGAACTGCTGGAG
hide sequence
RefSeq Acc Id:
XM_006246770 ⟹ XP_006246832
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,631,469 - 53,699,550 (+) NCBI mRatBN7.2 10 53,132,585 - 53,200,663 (+) NCBI Rnor_6.0 10 55,013,686 - 55,078,986 (+) NCBI Rnor_5.0 10 54,757,809 - 54,822,968 (+) NCBI
Sequence:
GGTATTGCGACCCGGCAGATGCTGGGACTTGCTGCCGGGCTCCAGCCACTGAACGGTGGTCGGGGACTCACCCCAACTGCTGAGAGTCGCCGCAGGAGAGGGGCTCAGCGCCCGGCGCCCGGCGGAGA
hide sequence
RefSeq Acc Id:
XM_017597454 ⟹ XP_017452943
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,631,469 - 53,699,550 (+) NCBI mRatBN7.2 10 53,132,585 - 53,200,663 (+) NCBI Rnor_6.0 10 55,013,686 - 55,078,986 (+) NCBI
Sequence:
GGTATTGCGACCCGGCAGATGCTGGGACTTGCTGCCGGGCTCCAGCCACTGAACGGTGGTCGGGGACTCACCCCAACTGCTGAGAGTCGCCGCAGGAGAGGGGCTCAGCGCCCGGCGCCCGGCGGAGA
hide sequence
RefSeq Acc Id:
XM_039086573 ⟹ XP_038942501
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,631,555 - 53,699,550 (+) NCBI mRatBN7.2 10 53,132,612 - 53,200,663 (+) NCBI
RefSeq Acc Id:
XM_063269618 ⟹ XP_063125688
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,670,884 - 53,699,550 (+) NCBI
RefSeq Acc Id:
XM_063269619 ⟹ XP_063125689
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 53,637,672 - 53,699,550 (+) NCBI
RefSeq Acc Id:
NP_001178852 ⟸ NM_001191923
- UniProtKB:
D4A4I3 (UniProtKB/TrEMBL), A6HFK4 (UniProtKB/TrEMBL)
- Sequence:
MQPAATTCTEDRIQHALERCLHGLSLGRRSAPWSAGLCLNCWSLQELVSRDPGHFLILLEQILQKTQEVQEKGTYDLLAPLALLFYSTVLCTPHFPPDSDLLLKAASTYHCFLTWPVPYCSICREMLT
hide sequence
RefSeq Acc Id:
XP_006246832 ⟸ XM_006246770
- Peptide Label:
isoform X1
- UniProtKB:
D4A4I3 (UniProtKB/TrEMBL), A6HFK4 (UniProtKB/TrEMBL)
- Sequence:
MQPAATTCTEDRIQHALERCLHGLSLGRRSAPWSAGLCLNCWSLQELVSRDPGHFLILLEQILQKTQEVQEKGTYDLLAPLALLFYSTVLCTPHFPPDSDLLLKAASTYHCFLTWPVPYCSICREMLT
hide sequence
RefSeq Acc Id:
XP_017452943 ⟸ XM_017597454
- Peptide Label:
isoform X2
- UniProtKB:
A6HFK4 (UniProtKB/TrEMBL)
- Sequence:
MQPAATTCTEDRIQHALERCLHGLSLGRRSAPWSAGLCLNCWSLQELVSRDPGHFLILLEQILQKTQEVQEKGTYDLLAPLALLFYSTVLCTPHFPPDSDLLLKAASTYHCFLTWPVPYCSICREMLT
hide sequence
Ensembl Acc Id:
ENSRNOP00000030578 ⟸ ENSRNOT00000032785
RefSeq Acc Id:
XP_038942501 ⟸ XM_039086573
- Peptide Label:
isoform X1
- UniProtKB:
D4A4I3 (UniProtKB/TrEMBL), A6HFK4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125689 ⟸ XM_063269619
- Peptide Label:
isoform X1
- UniProtKB:
D4A4I3 (UniProtKB/TrEMBL), A6HFK4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125688 ⟸ XM_063269618
- Peptide Label:
isoform X1
- UniProtKB:
D4A4I3 (UniProtKB/TrEMBL), A6HFK4 (UniProtKB/TrEMBL)
RGD ID: 13697297 Promoter ID: EPDNEW_R7820 Type: multiple initiation site Name: Pik3r5_1 Description: phosphoinositide-3-kinase, regulatory subunit 5 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 55,013,702 - 55,013,762 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-09-09
Pik3r5
phosphoinositide-3-kinase, regulatory subunit 5
Pik3r5
phosphoinositide-3-kinase, regulatory subunit 5, p101
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-06
Pik3r5
phosphoinositide-3-kinase, regulatory subunit 5, p101
RGD1563261_predicted
similar to novel protein (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-07
RGD1563261_predicted
similar to novel protein (predicted)
LOC497931
similar to novel protein
Symbol and Name status set to approved
1299863 APPROVED
2006-02-09
LOC497931
similar to novel protein
Symbol and Name status set to provisional
70820 PROVISIONAL
