Symbol:
Pak5
Name:
p21 (RAC1) activated kinase 5
RGD ID:
1312009
Description:
Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in cellular response to starvation; intracellular signal transduction; and regulation of MAPK cascade. Predicted to act upstream of or within learning or memory; locomotory behavior; and negative regulation of extrinsic apoptotic signaling pathway. Predicted to be located in cytosol; mitochondrion; and nucleus. Predicted to be active in cytoplasm and synapse. Orthologous to human PAK5 (p21 (RAC1) activated kinase 5); PARTICIPATES IN epidermal growth factor/neuregulin signaling pathway; renal cell carcinoma pathway; T cell receptor signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC311450; p21 (CDKN1A)-activated kinase 7; p21 (RAC1) activated kinase 7; p21 protein (Cdc42/Rac)-activated kinase 7; p21-activated kinase 5; p21-activated kinase 7; PAK-5; PAK-7; Pak7; serine/threonine-protein kinase PAK 5; serine/threonine-protein kinase PAK 7
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PAK5 (p21 (RAC1) activated kinase 5) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Pak5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pak5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PAK5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PAK5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pak5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PAK5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PAK5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pak5 (p21 (RAC1) activated kinase 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
HBEGF (heparin binding EGF like growth factor) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
PAK5 (p21 (RAC1) activated kinase 5)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Pak5 (p21 (RAC1) activated kinase 5)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pak7 (p21 protein (Cdc42/Rac)-activated kinase 7)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
CLA4
Alliance
DIOPT (Hieranoid|OrthoFinder|PANTHER)
Drosophila melanogaster (fruit fly):
mbt
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
pak-2
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SKM1
Alliance
DIOPT (Hieranoid|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
pak5
Alliance
DIOPT (Ensembl Compara|OMA|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 143,848,404 - 144,156,674 (-) NCBI GRCr8 mRatBN7.2 3 123,395,678 - 123,703,967 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 123,396,497 - 123,703,930 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 127,299,735 - 127,598,969 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 135,876,723 - 136,175,955 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 133,555,363 - 133,854,570 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 129,042,232 - 129,357,512 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 129,042,742 - 129,357,491 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 135,530,902 - 135,841,101 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 124,152,033 - 124,457,585 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 3 124,057,603 - 124,363,156 (-) NCBI Celera 3 122,127,080 - 122,432,709 (-) NCBI Celera Cytogenetic Map 3 q36 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pak5 Rat 1,2-dichloroethane decreases expression ISO Pak5 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of PAK5 mRNA CTD PMID:28960355 Pak5 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of PAK5 mRNA CTD PMID:32109520 Pak5 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Pak5 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of PAK5 mRNA CTD PMID:24680724 and PMID:26377647 Pak5 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Pak5 Rat 4,4'-sulfonyldiphenol decreases expression ISO Pak5 (Mus musculus) 6480464 bisphenol S results in decreased expression of PAK5 mRNA CTD PMID:34850234 Pak5 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of PAK5 mRNA CTD PMID:24780913 Pak5 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of PAK5 mRNA CTD PMID:28959563 Pak5 Rat aflatoxin B1 decreases methylation ISO PAK5 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of PAK5 3' UTR and Aflatoxin B1 results in decreased methylation of PAK5 intron CTD PMID:30157460 Pak5 Rat aflatoxin B1 decreases expression ISO PAK5 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of PAK5 mRNA CTD PMID:32234424 and PMID:35690182 Pak5 Rat all-trans-retinoic acid multiple interactions ISO Pak5 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of PAK5 mRNA CTD PMID:36189433 Pak5 Rat benzo[a]pyrene decreases expression ISO PAK5 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of PAK5 mRNA CTD PMID:32234424 and PMID:35690182 Pak5 Rat benzo[a]pyrene affects methylation ISO PAK5 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PAK5 5' UTR and Benzo(a)pyrene affects the methylation of PAK5 promoter CTD PMID:27901495 Pak5 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PAK5 mRNA CTD PMID:25181051 Pak5 Rat bisphenol A decreases expression ISO Pak5 (Mus musculus) 6480464 bisphenol A results in decreased expression of PAK5 mRNA CTD PMID:32156529 Pak5 Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of PAK5 mRNA CTD PMID:33453195 Pak5 Rat cisplatin multiple interactions ISO Pak5 (Mus musculus) 6480464 [Cisplatin co-treated with Vinorelbine] results in decreased expression of PAK5 mRNA CTD PMID:21544650 Pak5 Rat clothianidin decreases expression ISO PAK5 (Homo sapiens) 6480464 clothianidin results in decreased expression of PAK5 mRNA CTD PMID:31626844 and PMID:35690182 Pak5 Rat cyclosporin A decreases methylation ISO PAK5 (Homo sapiens) 6480464 Cyclosporine results in decreased methylation of PAK5 promoter CTD PMID:27989131 Pak5 Rat dorsomorphin multiple interactions ISO PAK5 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Pak5 Rat ethanol affects expression ISO Pak5 (Mus musculus) 6480464 Ethanol affects the expression of PAK5 mRNA CTD PMID:30319688 Pak5 Rat ethylparaben decreases expression ISO PAK5 (Homo sapiens) 6480464 ethyl-p-hydroxybenzoate results in decreased expression of PAK5 mRNA CTD PMID:37690743 Pak5 Rat genistein decreases expression ISO Pak5 (Mus musculus) 6480464 Genistein results in decreased expression of PAK5 mRNA CTD PMID:32186404 Pak5 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of PAK5 mRNA CTD PMID:20080153 Pak5 Rat Lasiocarpine decreases expression ISO PAK5 (Homo sapiens) 6480464 lasiocarpine results in decreased expression of PAK5 mRNA CTD PMID:32234424 and PMID:35690182 Pak5 Rat lipopolysaccharide decreases expression ISO PAK5 (Homo sapiens) 6480464 Lipopolysaccharides results in decreased expression of PAK5 mRNA CTD PMID:35811015 Pak5 Rat lipopolysaccharide multiple interactions ISO PAK5 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Pak5 Rat methylmercury chloride decreases expression ISO PAK5 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of PAK5 mRNA CTD PMID:28001369 Pak5 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Pak5 (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of PAK5 mRNA CTD PMID:36189433 Pak5 Rat N-Nitrosopyrrolidine decreases expression ISO PAK5 (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in decreased expression of PAK5 mRNA CTD PMID:32234424 and PMID:35690182 Pak5 Rat O-methyleugenol decreases expression ISO PAK5 (Homo sapiens) 6480464 methyleugenol results in decreased expression of PAK5 mRNA CTD PMID:32234424 and PMID:35690182 Pak5 Rat paracetamol increases expression ISO PAK5 (Homo sapiens) 6480464 Acetaminophen results in increased expression of PAK5 mRNA CTD PMID:22230336 Pak5 Rat phenylmercury acetate decreases expression ISO PAK5 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of PAK5 mRNA CTD PMID:26272509 Pak5 Rat phenylmercury acetate multiple interactions ISO PAK5 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of PAK5 mRNA CTD PMID:27188386 Pak5 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO PAK5 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Pak5 Rat SB 431542 multiple interactions ISO PAK5 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Pak5 Rat sodium arsenite decreases expression ISO Pak5 (Mus musculus) 6480464 sodium arsenite results in decreased expression of PAK5 mRNA CTD PMID:36209798 Pak5 Rat titanium dioxide increases expression ISO Pak5 (Mus musculus) 6480464 titanium dioxide results in increased expression of PAK5 mRNA CTD PMID:29264374 Pak5 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of PAK5 mRNA CTD PMID:33387578 Pak5 Rat trichostatin A increases expression ISO PAK5 (Homo sapiens) 6480464 trichostatin A results in increased expression of PAK5 mRNA CTD PMID:24935251 Pak5 Rat valproic acid affects expression ISO PAK5 (Homo sapiens) 6480464 Valproic Acid affects the expression of PAK5 mRNA CTD PMID:25979313 Pak5 Rat valproic acid increases expression ISO PAK5 (Homo sapiens) 6480464 Valproic Acid results in increased expression of PAK5 mRNA CTD PMID:26272509 Pak5 Rat valproic acid multiple interactions ISO PAK5 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of PAK5 mRNA CTD PMID:27188386 Pak5 Rat vinorelbine multiple interactions ISO Pak5 (Mus musculus) 6480464 [Cisplatin co-treated with Vinorelbine] results in decreased expression of PAK5 mRNA CTD PMID:21544650
Imported Annotations - KEGG (archival)
1,2-dichloroethane (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) acrylamide (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) cadmium dichloride (EXP) cisplatin (ISO) clothianidin (ISO) cyclosporin A (ISO) dorsomorphin (ISO) ethanol (ISO) ethylparaben (ISO) genistein (ISO) ketamine (EXP) Lasiocarpine (ISO) lipopolysaccharide (ISO) methylmercury chloride (ISO) mono(2-ethylhexyl) phthalate (ISO) N-Nitrosopyrrolidine (ISO) O-methyleugenol (ISO) paracetamol (ISO) phenylmercury acetate (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) sodium arsenite (ISO) titanium dioxide (ISO) trichloroethene (EXP) trichostatin A (ISO) valproic acid (ISO) vinorelbine (ISO)
Pak5 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 143,848,404 - 144,156,674 (-) NCBI GRCr8 mRatBN7.2 3 123,395,678 - 123,703,967 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 123,396,497 - 123,703,930 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 127,299,735 - 127,598,969 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 135,876,723 - 136,175,955 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 133,555,363 - 133,854,570 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 129,042,232 - 129,357,512 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 129,042,742 - 129,357,491 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 135,530,902 - 135,841,101 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 124,152,033 - 124,457,585 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 3 124,057,603 - 124,363,156 (-) NCBI Celera 3 122,127,080 - 122,432,709 (-) NCBI Celera Cytogenetic Map 3 q36 NCBI
PAK5 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 20 9,537,370 - 9,839,076 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 20 9,537,370 - 9,839,076 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 20 9,518,017 - 9,819,724 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 20 9,466,037 - 9,767,522 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 20 9,466,036 - 9,767,522 NCBI Celera 20 9,588,063 - 9,889,850 (-) NCBI Celera Cytogenetic Map 20 p12.2 NCBI HuRef 20 9,470,003 - 9,771,581 (-) NCBI HuRef CHM1_1 20 9,519,190 - 9,820,790 (-) NCBI CHM1_1 T2T-CHM13v2.0 20 9,580,273 - 9,881,978 (-) NCBI T2T-CHM13v2.0
Pak5 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 135,923,008 - 136,229,899 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 135,923,024 - 136,229,887 (-) Ensembl GRCm39 Ensembl GRCm38 2 136,081,088 - 136,387,968 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 136,081,104 - 136,387,967 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 135,906,824 - 136,213,703 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 2 135,773,340 - 136,079,379 (-) NCBI MGSCv36 mm8 Celera 2 137,278,994 - 137,585,755 (-) NCBI Celera Cytogenetic Map 2 F3 NCBI cM Map 2 67.32 NCBI
Pak5 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955415 19,511,822 - 19,619,663 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955415 19,509,727 - 19,826,087 (-) NCBI ChiLan1.0 ChiLan1.0
PAK5 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 21 10,436,346 - 10,738,368 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 20 10,433,177 - 10,735,194 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 20 9,510,789 - 9,812,689 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 20 9,513,009 - 9,813,708 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 20 9,513,009 - 9,619,750 (-) Ensembl panpan1.1 panPan2
PAK5 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 24 12,391,739 - 12,671,483 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 24 12,391,471 - 12,669,404 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 24 12,210,533 - 12,496,682 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 24 12,804,073 - 13,084,553 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 24 12,804,113 - 13,082,849 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 24 12,410,639 - 12,690,260 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 24 12,510,137 - 12,789,767 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 24 12,853,704 - 13,133,934 (+) NCBI UU_Cfam_GSD_1.0
Pak5 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 161,148,089 - 161,500,798 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936485 9,633,230 - 9,932,174 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936485 9,825,425 - 9,932,162 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PAK5 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 17 18,461,062 - 18,785,313 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 17 18,461,060 - 18,785,869 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 17 20,828,842 - 21,258,863 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PAK5 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 2 28,287,478 - 28,595,382 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 2 28,288,945 - 28,595,686 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666071 15,978,895 - 16,289,799 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pak5
.
Predicted Target Of
Count of predictions: 240 Count of miRNA genes: 157 Interacting mature miRNAs: 194 Transcripts: ENSRNOT00000007410 Prediction methods: Miranda, Targetscan Result types: miRGate_prediction
2312673 Scl63 Serum cholesterol level QTL 63 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 3 98535255 168026850 Rat 1598877 Bp285 Blood pressure QTL 285 1.5 0.03 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 120538241 165538241 Rat 2302373 Gluco39 Glucose level QTL 39 5.01 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 3 98535386 161695835 Rat 70216 Cm14 Cardiac mass QTL 14 2.1 heart mass (VT:0007028) heart wet weight (CMO:0000069) 3 31172320 163586636 Rat 2292591 Esta4 Estrogen-induced thymic atrophy QTL 4 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 3 47233211 147415807 Rat 1358362 Srcrt2 Stress Responsive Cort QTL 2 2.78 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 3 38192233 133483320 Rat 1581568 Rf53 Renal function QTL 53 urine total protein amount (VT:0000032) urine protein excretion rate to body weight ratio (CMO:0001099) 3 56395968 161299569 Rat 7387306 Bw124 Body weight QTL 124 3.2 0.0003 body mass (VT:0001259) body weight (CMO:0000012) 3 84091273 129091273 Rat 1578754 Stresp16 Stress response QTL 16 4 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 3 112681431 157681431 Rat 1300173 Rf11 Renal function QTL 11 3.38 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 3 121056165 145956249 Rat 8694437 Bw167 Body weight QTL 167 22.46 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 3 91797474 136797474 Rat 10755461 Coatc16 Coat color QTL 16 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 3 122438700 167438700 Rat 8662816 Vetf4 Vascular elastic tissue fragility QTL 4 4 renal artery integrity trait (VT:0010642) number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563) 3 59242096 157323038 Rat 1559282 Emca5 Estrogen-induced mammary cancer QTL 5 3.9 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 3 43827364 169034231 Rat 1354611 Despr2 Despair related QTL 2 3.03 0.0028 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 3 97084464 142084464 Rat 631649 Bp123 Blood pressure QTL 123 3.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 89772419 134772419 Rat 631841 Niddm39 Non-insulin dependent diabetes mellitus QTL 39 3.36 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 94856903 159898684 Rat 1358204 Insglur1 Insulin/glucose ratio QTL 1 3.8 blood glucose amount (VT:0000188) serum glucose level (CMO:0000543) 3 115638168 135181505 Rat 1576306 Schws3 Schwannoma susceptibility QTL 3 0.001 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 3 118839124 163839124 Rat 619618 Rf3 Renal disease susceptibility QTL 3 6.5 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate to body weight ratio (CMO:0001270) 3 107693393 152693393 Rat 1300159 Kidm4 Kidney mass QTL 4 3.83 kidney mass (VT:0002707) right kidney wet weight to body weight ratio (CMO:0001953) 3 121056165 157309487 Rat 2301971 Cm71 Cardiac mass QTL 71 4.63 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 3 41874578 155617519 Rat 2312659 Slep7 Serum leptin concentration QTL 7 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 3 98535255 168026850 Rat 2301970 Bw81 Body weight QTL 81 5.19 body mass (VT:0001259) body weight (CMO:0000012) 3 41874578 155617519 Rat 1581546 Pur13 Proteinuria QTL 13 2.93 0.0335 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 3 78196190 146592722 Rat 1331758 Bp207 Blood pressure QTL 207 2.848 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 3 112287552 135181505 Rat 2293087 Iddm27 Insulin dependent diabetes mellitus QTL 27 2.68 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 97551417 147415807 Rat 2312670 Bw94 Body weight QTL 94 0.01 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 3 98535255 168026850 Rat 724532 Cm17 Cardiac mass QTL 17 2 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 3 95735366 140735366 Rat
D3Rat156
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 3 143,965,998 - 143,966,100 (+) Marker Load Pipeline mRatBN7.2 3 123,513,284 - 123,513,386 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,166,111 - 129,166,212 NCBI Rnor6.0 Rnor_5.0 3 135,651,587 - 135,651,688 UniSTS Rnor5.0 RGSC_v3.4 3 124,268,926 - 124,269,028 RGD RGSC3.4 RGSC_v3.4 3 124,268,927 - 124,269,028 UniSTS RGSC3.4 RGSC_v3.1 3 124,174,278 - 124,174,628 RGD Celera 3 122,243,230 - 122,243,331 UniSTS SHRSP x BN Map 3 60.7499 UniSTS SHRSP x BN Map 3 60.7499 RGD Cytogenetic Map 3 q36 UniSTS
D3Rat254
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,471,156 - 123,471,394 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,123,946 - 129,124,183 NCBI Rnor6.0 Rnor_5.0 3 135,609,422 - 135,609,659 UniSTS Rnor5.0 RGSC_v3.4 3 124,226,798 - 124,227,036 RGD RGSC3.4 RGSC_v3.4 3 124,226,799 - 124,227,036 UniSTS RGSC3.4 RGSC_v3.1 3 124,132,371 - 124,132,609 RGD Celera 3 122,201,188 - 122,201,425 UniSTS SHRSP x BN Map 3 60.8299 RGD SHRSP x BN Map 3 60.8299 UniSTS Cytogenetic Map 3 q36 UniSTS
RH144603
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,475,043 - 123,475,198 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,127,833 - 129,127,987 NCBI Rnor6.0 Rnor_5.0 3 135,613,309 - 135,613,463 UniSTS Rnor5.0 RGSC_v3.4 3 124,230,686 - 124,230,840 UniSTS RGSC3.4 Celera 3 122,205,075 - 122,205,229 UniSTS RH 3.4 Map 3 1087.3 UniSTS Cytogenetic Map 3 q36 UniSTS
BF400086
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,687,059 - 123,687,248 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,340,355 - 129,340,543 NCBI Rnor6.0 Rnor_5.0 3 135,824,758 - 135,824,946 UniSTS Rnor5.0 RGSC_v3.4 3 124,440,613 - 124,440,801 UniSTS RGSC3.4 Celera 3 122,415,921 - 122,416,109 UniSTS RH 3.4 Map 3 1088.0 UniSTS Cytogenetic Map 3 q36 UniSTS
BF397900
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,431,448 - 123,431,573 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,077,985 - 129,078,109 NCBI Rnor6.0 Rnor_5.0 3 135,565,719 - 135,565,843 UniSTS Rnor5.0 RGSC_v3.4 3 124,187,173 - 124,187,297 UniSTS RGSC3.4 Celera 3 122,161,835 - 122,161,959 UniSTS RH 3.4 Map 3 1086.0 UniSTS Cytogenetic Map 3 q36 UniSTS
BF405154
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,396,742 - 123,396,925 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,043,289 - 129,043,471 NCBI Rnor6.0 Rnor_5.0 3 135,531,148 - 135,531,330 UniSTS Rnor5.0 RGSC_v3.4 3 124,152,279 - 124,152,461 UniSTS RGSC3.4 Celera 3 122,127,326 - 122,127,508 UniSTS RH 3.4 Map 3 1084.6 UniSTS Cytogenetic Map 3 q36 UniSTS
RH137684
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 3 143,848,460 - 143,848,708 (+) Marker Load Pipeline mRatBN7.2 3 123,395,734 - 123,395,982 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,042,281 - 129,042,528 NCBI Rnor6.0 Rnor_5.0 3 135,530,140 - 135,530,387 UniSTS Rnor5.0 RGSC_v3.4 3 124,151,271 - 124,151,518 UniSTS RGSC3.4 Celera 3 122,126,318 - 122,126,565 UniSTS RH 3.4 Map 3 1087.9 UniSTS Cytogenetic Map 3 q36 UniSTS
RH137907
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 123,421,169 - 123,421,301 (+) MAPPER mRatBN7.2 Rnor_6.0 3 129,067,715 - 129,067,846 NCBI Rnor6.0 Rnor_5.0 3 135,555,449 - 135,555,580 UniSTS Rnor5.0 RGSC_v3.4 3 124,176,903 - 124,177,034 UniSTS RGSC3.4 Celera 3 122,151,736 - 122,151,867 UniSTS Cytogenetic Map 3 q36 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
8
4
46
112
61
58
34
10
34
6
149
71
93
32
57
24
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000007410 ⟹ ENSRNOP00000007410
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 3 123,396,497 - 123,703,930 (-) Ensembl Rnor_6.0 Ensembl 3 129,043,043 - 129,357,491 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000084829 ⟹ ENSRNOP00000071237
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 3 129,042,742 - 129,357,348 (-) Ensembl
RefSeq Acc Id:
NM_001107781 ⟹ NP_001101251
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 143,849,223 - 144,156,640 (-) NCBI mRatBN7.2 3 123,396,497 - 123,703,930 (-) NCBI Rnor_6.0 3 129,043,043 - 129,357,491 (-) NCBI Rnor_5.0 3 135,530,902 - 135,841,101 (-) NCBI RGSC_v3.4 3 124,152,033 - 124,457,585 (-) RGD Celera 3 122,127,080 - 122,432,709 (-) RGD
Sequence:
CCGGAGCAGCTGAATGGTCTCAGCGGACAGTCTTCCTAGGGGCAAGTCAGGCGGCTTGGGCATGCTCAGTAGCTGGGAGAGGTTTGGGAGGAGAGTAGAAAGCTTTGACTCTGCCCCCACCCCCTCCT
hide sequence
RefSeq Acc Id:
XM_017591756 ⟹ XP_017447245
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 143,848,404 - 144,156,674 (-) NCBI mRatBN7.2 3 123,395,678 - 123,703,967 (-) NCBI Rnor_6.0 3 129,042,232 - 129,357,512 (-) NCBI
Sequence:
ACAGCCGGCTGCTCCGAAAACCCGGAGCAGCTGAATGGTCTCAGCGGACAGTCTTCCTAGGGGCAAGTCAGGCGGCTTGGGCATGCTCAGTAGCTGGGAGAGGTTTGGGAGGAGAGTAGAAAGCTTTG
hide sequence
RefSeq Acc Id:
XM_017591757 ⟹ XP_017447246
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 143,848,404 - 144,057,873 (-) NCBI mRatBN7.2 3 123,395,678 - 123,604,729 (-) NCBI Rnor_6.0 3 129,042,232 - 129,256,582 (-) NCBI
Sequence:
TTTAGGATTCCAAGTCCATGGGATGGTGCTACCCACAGTGGCCATTTTTCCCATGTCATTAATA
hide sequence
RefSeq Acc Id:
XM_039105018 ⟹ XP_038960946
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 143,848,404 - 144,156,648 (-) NCBI mRatBN7.2 3 123,395,678 - 123,703,967 (-) NCBI
RefSeq Acc Id:
NP_001101251 ⟸ NM_001107781
- UniProtKB:
D4A280 (UniProtKB/Swiss-Prot)
- Sequence:
MFGKKKKKIEISGPSNFEHRVHTGFDPQEQKFTGLPQQWHSLLADTANRPKPMVDPSCITPIQLAPMKTIVRGNKSCKESSINGLLEDFDNISVTRSNSLRKESPPTPDQGAASRIQGHSEENGFITF
hide sequence
RefSeq Acc Id:
XP_017447245 ⟸ XM_017591756
- Peptide Label:
isoform X1
- Sequence:
MFGKKKKKIEISGPSNFEHRVHTGFDPQEQKFTGLPQQWHSLLADTANRPKPMVDPSCITPIQLAPMKTIVRGNKSCKESSINGLLEDFDNISVTRSNSLRKESPPTPDQGAASRIQGHSEENGFITF
hide sequence
RefSeq Acc Id:
XP_017447246 ⟸ XM_017591757
- Peptide Label:
isoform X1
- UniProtKB:
D4A280 (UniProtKB/Swiss-Prot)
- Sequence:
MFGKKKKKIEISGPSNFEHRVHTGFDPQEQKFTGLPQQWHSLLADTANRPKPMVDPSCITPIQLAPMKTIVRGNKSCKESSINGLLEDFDNISVTRSNSLRKESPPTPDQGAASRIQGHSEENGFITF
hide sequence
Ensembl Acc Id:
ENSRNOP00000071237 ⟸ ENSRNOT00000084829
Ensembl Acc Id:
ENSRNOP00000007410 ⟸ ENSRNOT00000007410
RefSeq Acc Id:
XP_038960946 ⟸ XM_039105018
- Peptide Label:
isoform X1
RGD ID: 13692468 Promoter ID: EPDNEW_R2987 Type: single initiation site Name: Pak7_1 Description: p21 activated kinase 7 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 3 129,357,329 - 129,357,389 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2020-06-25
Pak5
p21 (RAC1) activated kinase 5
Pak7
p21 (RAC1) activated kinase 7
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2016-05-12
Pak7
p21 (RAC1) activated kinase 7
Pak7
p21 protein (Cdc42/Rac)-activated kinase 7
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2009-05-27
Pak7
p21 protein (Cdc42/Rac)-activated kinase 7
Pak7
p21 (CDKN1A)-activated kinase 7
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Pak7
p21 (CDKN1A)-activated kinase 7
Pak7_predicted
p21 (CDKN1A)-activated kinase 7 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Pak7_predicted
p21 (CDKN1A)-activated kinase 7 (predicted)
Symbol and Name status set to approved
70820 APPROVED
