Symbol:
Bap1
Name:
BRCA1 associated deubiquitinase 1 (Ensembl:Brca1 associated protein 1)
RGD ID:
1311938
Description:
Predicted to enable chromatin DNA binding activity; cysteine-type deubiquitinase activity; and histone H2A deubiquitinase activity. Predicted to be involved in several processes, including myeloid cell differentiation; negative regulation of macromolecule biosynthetic process; and protein deubiquitination. Predicted to act upstream of or within macrophage homeostasis; regulation of cytokine production involved in inflammatory response; and regulation of inflammatory response. Predicted to be located in cytosol and nucleoplasm. Predicted to be part of PR-DUB complex. Predicted to be active in cytoplasm. Human ortholog(s) of this gene implicated in basal cell carcinoma; extrahepatic bile duct adenocarcinoma; and uveal melanoma. Orthologous to human BAP1 (BRCA1 associated deubiquitinase 1); PARTICIPATES IN histone modification pathway; INTERACTS WITH 2,4-dinitrotoluene; acrylamide; bisphenol A.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
Brca1 associated protein 1; BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase); BRCA1-associated protein 1; LOC306257; ubiquitin carboxyl-terminal hydrolase BAP1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 6,453,126 - 6,461,952 (+) NCBI GRCr8 mRatBN7.2 16 6,446,709 - 6,455,535 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 6,446,709 - 6,455,535 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 6,458,869 - 6,467,694 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 7,603,765 - 7,612,590 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 6,466,025 - 6,474,848 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 7,336,685 - 7,345,511 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 7,336,685 - 7,345,511 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 7,265,075 - 7,273,901 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 6,684,470 - 6,693,296 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 6,684,871 - 6,691,564 (+) NCBI Celera 16 8,733,498 - 8,742,324 (-) NCBI Celera Cytogenetic Map 16 p16 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Bap1 Rat (S)-nicotine multiple interactions ISO Bap1 (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Bap1 Rat 1,2-dimethylhydrazine multiple interactions ISO Bap1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of BAP1 mRNA CTD PMID:22206623 Bap1 Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine increases expression ISO Bap1 (Mus musculus) 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Bap1 Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine multiple interactions ISO Bap1 (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Bap1 Rat 17beta-estradiol increases expression ISO Bap1 (Mus musculus) 6480464 Estradiol results in increased expression of BAP1 mRNA CTD PMID:39298647 Bap1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Bap1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to BAP1 promoter] CTD PMID:19654925 Bap1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Bap1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of BAP1 mRNA CTD PMID:21570461 Bap1 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of BAP1 mRNA CTD PMID:21346803 Bap1 Rat 2-hydroxypropanoic acid increases expression ISO BAP1 (Homo sapiens) 6480464 Lactic Acid results in increased expression of BAP1 mRNA CTD PMID:30851411 Bap1 Rat acetylsalicylic acid decreases expression ISO BAP1 (Homo sapiens) 6480464 Aspirin results in decreased expression of BAP1 mRNA CTD PMID:15928584 Bap1 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of BAP1 mRNA CTD PMID:28959563 Bap1 Rat afimoxifene affects response to substance ISO BAP1 (Homo sapiens) 6480464 BAP1 gene affects the susceptibility to afimoxifene CTD PMID:21482774 Bap1 Rat aflatoxin B1 increases expression ISO Bap1 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of BAP1 mRNA CTD PMID:19770486 Bap1 Rat arsenous acid affects expression ISO BAP1 (Homo sapiens) 6480464 Arsenic Trioxide affects the expression of BAP1 mRNA CTD PMID:17530438 Bap1 Rat asbestos increases response to substance ISO Bap1 (Mus musculus) 6480464 BAP1 gene mutant form results in increased susceptibility to Asbestos CTD PMID:24928783 Bap1 Rat asbestos increases mutagenesis ISO BAP1 (Homo sapiens) 6480464 Asbestos results in increased mutagenesis of BAP1 gene CTD PMID:26463840 Bap1 Rat benzene increases expression ISO BAP1 (Homo sapiens) 6480464 Benzene results in increased expression of BAP1 mRNA CTD PMID:19162166 Bap1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Bap1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of BAP1 mRNA CTD PMID:21318169 Bap1 Rat bis(2-ethylhexyl) phthalate increases expression ISO Bap1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of BAP1 mRNA CTD PMID:34319233 Bap1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of BAP1 mRNA CTD PMID:25181051 Bap1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of BAP1 gene CTD PMID:28505145 Bap1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of BAP1 mRNA CTD PMID:30816183 and PMID:32528016 Bap1 Rat cadmium atom multiple interactions ISO BAP1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of BAP1 mRNA CTD PMID:35301059 Bap1 Rat cadmium dichloride decreases expression ISO BAP1 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of BAP1 mRNA CTD PMID:38568856 Bap1 Rat cadmium dichloride multiple interactions ISO BAP1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of BAP1 mRNA CTD PMID:35301059 Bap1 Rat caffeine affects phosphorylation ISO BAP1 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of BAP1 protein CTD PMID:35688186 Bap1 Rat CGP 52608 multiple interactions ISO BAP1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to BAP1 gene] CTD PMID:28238834 Bap1 Rat choline multiple interactions ISO Bap1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of BAP1 gene CTD PMID:20938992 Bap1 Rat coumarin affects phosphorylation ISO BAP1 (Homo sapiens) 6480464 coumarin affects the phosphorylation of BAP1 protein CTD PMID:35688186 Bap1 Rat crocidolite asbestos increases response to substance ISO Bap1 (Mus musculus) 6480464 BAP1 gene mutant form results in increased susceptibility to Asbestos and Crocidolite CTD PMID:26119930 Bap1 Rat cycloheximide multiple interactions ISO Bap1 (Mus musculus) 6480464 BAP1 inhibits the reaction [Cycloheximide results in increased degradation of BRCA1 protein] CTD PMID:37414201 Bap1 Rat cyclosporin A increases methylation ISO BAP1 (Homo sapiens) 6480464 Cyclosporine results in increased methylation of BAP1 promoter CTD PMID:27989131 Bap1 Rat diarsenic trioxide affects expression ISO BAP1 (Homo sapiens) 6480464 Arsenic Trioxide affects the expression of BAP1 mRNA CTD PMID:17530438 Bap1 Rat Dibutyl phosphate affects expression ISO BAP1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of BAP1 mRNA CTD PMID:37042841 Bap1 Rat dioxygen multiple interactions ISO Bap1 (Mus musculus) 6480464 [sulforaphane affects the susceptibility to Oxygen] which affects the expression of BAP1 mRNA CTD PMID:30529165 Bap1 Rat doxorubicin decreases expression ISO BAP1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of BAP1 mRNA CTD PMID:29803840 Bap1 Rat elemental selenium increases expression ISO BAP1 (Homo sapiens) 6480464 Selenium results in increased expression of BAP1 mRNA CTD PMID:19244175 Bap1 Rat ethanol affects splicing ISO Bap1 (Mus musculus) 6480464 Ethanol affects the splicing of BAP1 mRNA CTD PMID:30319688 Bap1 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of BAP1 mRNA CTD PMID:24136188 Bap1 Rat folic acid multiple interactions ISO Bap1 (Mus musculus) 6480464 [1 more ... CTD PMID:20938992 and PMID:22206623 Bap1 Rat FR900359 increases phosphorylation ISO BAP1 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of BAP1 protein CTD PMID:37730182 Bap1 Rat L-methionine multiple interactions ISO Bap1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of BAP1 gene CTD PMID:20938992 Bap1 Rat lipopolysaccharide multiple interactions ISO Bap1 (Mus musculus) 6480464 BAP1 inhibits the reaction [Lipopolysaccharides results in decreased expression of BRCA1 protein] more ... CTD PMID:37414201 Bap1 Rat lipopolysaccharide decreases expression ISO Bap1 (Mus musculus) 6480464 Lipopolysaccharides results in decreased expression of BAP1 mRNA and Lipopolysaccharides results in decreased expression of BAP1 protein CTD PMID:37414201 Bap1 Rat lycopene increases expression ISO BAP1 (Homo sapiens) 6480464 lycopene results in increased expression of BAP1 mRNA CTD PMID:16886892 Bap1 Rat methidathion increases expression ISO Bap1 (Mus musculus) 6480464 methidathion results in increased expression of BAP1 mRNA CTD PMID:34813904 Bap1 Rat nicotine multiple interactions ISO Bap1 (Mus musculus) 6480464 [Nicotine co-treated with 1-Methyl-4-phenyl-1 more ... CTD PMID:20230807 Bap1 Rat nitrates multiple interactions ISO Bap1 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of BAP1 mRNA CTD PMID:35964746 Bap1 Rat olaparib increases response to substance ISO BAP1 (Homo sapiens) 6480464 BAP1 gene mutant form results in increased susceptibility to olaparib CTD PMID:22683710 Bap1 Rat ozone multiple interactions ISO BAP1 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of BAP1 mRNA CTD PMID:35430440 Bap1 Rat paracetamol affects expression ISO Bap1 (Mus musculus) 6480464 Acetaminophen affects the expression of BAP1 mRNA CTD PMID:17562736 Bap1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of BAP1 mRNA CTD PMID:33387578 Bap1 Rat perfluorohexanesulfonic acid decreases expression ISO Bap1 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in decreased expression of BAP1 mRNA CTD PMID:37995155 Bap1 Rat pirinixic acid multiple interactions ISO Bap1 (Mus musculus) 6480464 PPARA protein affects the reaction [pirinixic acid results in increased expression of BAP1 mRNA] CTD PMID:21318169 Bap1 Rat pirinixic acid increases expression ISO Bap1 (Mus musculus) 6480464 pirinixic acid results in increased expression of BAP1 mRNA CTD PMID:21318169 Bap1 Rat rac-lactic acid increases expression ISO BAP1 (Homo sapiens) 6480464 Lactic Acid results in increased expression of BAP1 mRNA CTD PMID:30851411 Bap1 Rat raloxifene multiple interactions ISO Bap1 (Mus musculus) 6480464 [SOD1 protein mutant form affects the susceptibility to Raloxifene Hydrochloride] which results in decreased expression of BAP1 mRNA CTD PMID:33269387 Bap1 Rat resveratrol decreases expression ISO BAP1 (Homo sapiens) 6480464 resveratrol results in decreased expression of BAP1 mRNA CTD PMID:12569576 Bap1 Rat selenium atom increases expression ISO BAP1 (Homo sapiens) 6480464 Selenium results in increased expression of BAP1 mRNA CTD PMID:19244175 Bap1 Rat sulforaphane multiple interactions ISO Bap1 (Mus musculus) 6480464 [sulforaphane affects the susceptibility to Oxygen] which affects the expression of BAP1 mRNA CTD PMID:30529165 Bap1 Rat toluene decreases expression ISO BAP1 (Homo sapiens) 6480464 Toluene results in decreased expression of BAP1 mRNA CTD PMID:28245982 Bap1 Rat triphenyl phosphate affects expression ISO BAP1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of BAP1 mRNA CTD PMID:37042841 Bap1 Rat valproic acid increases methylation ISO BAP1 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of BAP1 gene CTD PMID:29154799 Bap1 Rat vitamin E increases expression ISO BAP1 (Homo sapiens) 6480464 Vitamin E results in increased expression of BAP1 mRNA CTD PMID:19244175
Biological Process
cell differentiation (IEA) cell population proliferation (IEA,ISO) chromatin organization (IEA) chromatin remodeling (IEA) common myeloid progenitor cell proliferation (IEA,ISO) erythrocyte differentiation (IEA,ISO) erythrocyte maturation (IEA,ISO) gene expression (IEA,ISO) granulocyte differentiation (IEA,ISO) hematopoietic stem cell homeostasis (IEA,ISO) heterochromatin formation (IBA) in utero embryonic development (IEA,ISO) leukocyte proliferation (IEA,ISO) macrophage homeostasis (IEA,ISO) mitotic cell cycle (IEA,ISO) monoubiquitinated protein deubiquitination (IEA,ISO,ISS) myeloid cell apoptotic process (IEA,ISO) negative regulation of DNA-templated transcription (IEA,ISO,ISS) neuron cellular homeostasis (IEA,ISO) neutrophil differentiation (IEA,ISO) nucleate erythrocyte differentiation (IEA,ISO) platelet morphogenesis (IEA,ISO) positive regulation of protein targeting to mitochondrion (ISO) protein deubiquitination (IEA,ISO,ISS) protein K48-linked deubiquitination (IEA,ISO,ISS) proteolysis (IEA) regulation of cell cycle (IEA,ISO,ISS) regulation of cell growth (IEA,ISO,ISS) regulation of cytokine production involved in inflammatory response (IEA,ISO) regulation of inflammatory response (IEA,ISO) thrombocyte differentiation (IEA,ISO) tissue homeostasis (IEA,ISO) ubiquitin-dependent protein catabolic process (IEA)
1.
H2A-DUBbing the mammalian epigenome: expanding frontiers for histone H2A deubiquitinating enzymes in cell biology and physiology.
Belle JI and Nijnik A, Int J Biochem Cell Biol. 2014 May;50:161-74. doi: 10.1016/j.biocel.2014.03.004. Epub 2014 Mar 16.
2.
Mutation profiling in cholangiocarcinoma: prognostic and therapeutic implications.
Churi CR, etal., PLoS One. 2014 Dec 23;9(12):e115383. doi: 10.1371/journal.pone.0115383. eCollection 2014.
3.
Germline BAP1 mutations predispose also to multiple basal cell carcinomas.
de la Fouchardiere A, etal., Clin Genet. 2014 Jul 31. doi: 10.1111/cge.12472.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
7.
Intrahepatic cholangiocarcinoma frequently shows loss of BAP1 and PBRM1 expression, and demonstrates specific clinicopathological and genetic characteristics with BAP1 loss.
Misumi K, etal., Histopathology. 2017 Apr;70(5):766-774. doi: 10.1111/his.13127. Epub 2017 Jan 18.
8.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
9.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
BRCA1-Associated Protein 1 (BAP1) Immunohistochemical Expression as a Diagnostic Tool in Malignant Pleural Mesothelioma Classification: A Large Retrospective Study.
Righi L, etal., J Thorac Oncol. 2016 Nov;11(11):2006-2017. doi: 10.1016/j.jtho.2016.06.020. Epub 2016 Jul 13.
12.
Prognostic parameters in uveal melanoma and their association with BAP1 expression.
van Essen TH, etal., Br J Ophthalmol. 2014 Aug 21. pii: bjophthalmol-2014-305047. doi: 10.1136/bjophthalmol-2014-305047.
13.
Germline mutation of bap1 accelerates development of asbestos-induced malignant mesothelioma.
Xu J, etal., Cancer Res. 2014 Aug 15;74(16):4388-97. doi: 10.1158/0008-5472.CAN-14-1328. Epub 2014 Jun 13.
Bap1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 6,453,126 - 6,461,952 (+) NCBI GRCr8 mRatBN7.2 16 6,446,709 - 6,455,535 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 6,446,709 - 6,455,535 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 6,458,869 - 6,467,694 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 7,603,765 - 7,612,590 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 6,466,025 - 6,474,848 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 7,336,685 - 7,345,511 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 7,336,685 - 7,345,511 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 7,265,075 - 7,273,901 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 6,684,470 - 6,693,296 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 6,684,871 - 6,691,564 (+) NCBI Celera 16 8,733,498 - 8,742,324 (-) NCBI Celera Cytogenetic Map 16 p16 NCBI
BAP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 52,401,008 - 52,410,008 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 52,401,008 - 52,410,008 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 52,435,024 - 52,444,024 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 52,410,064 - 52,419,049 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 3 52,410,066 - 52,419,049 NCBI Celera 3 52,414,346 - 52,423,331 (-) NCBI Celera Cytogenetic Map 3 p21.1 NCBI HuRef 3 52,497,655 - 52,506,755 (-) NCBI HuRef CHM1_1 3 52,387,546 - 52,396,647 (-) NCBI CHM1_1 T2T-CHM13v2.0 3 52,433,990 - 52,442,989 (-) NCBI T2T-CHM13v2.0
Bap1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 30,973,358 - 30,981,887 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 30,973,407 - 30,981,901 (+) Ensembl GRCm39 Ensembl GRCm38 14 31,251,352 - 31,259,930 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 31,251,450 - 31,259,944 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 32,064,675 - 32,073,115 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 30,080,596 - 30,088,939 (+) NCBI MGSCv36 mm8 Celera 14 27,510,099 - 27,518,539 (+) NCBI Celera Cytogenetic Map 14 B NCBI cM Map 14 19.09 NCBI
Bap1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955430 2,390,524 - 2,400,645 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955430 2,391,970 - 2,400,645 (-) NCBI ChiLan1.0 ChiLan1.0
BAP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 52,396,300 - 52,405,519 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 52,401,975 - 52,410,291 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 52,344,067 - 52,352,187 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 53,573,785 - 53,581,943 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 53,573,785 - 53,581,943 (-) Ensembl panpan1.1 panPan2
BAP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 20 37,355,499 - 37,364,298 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 20 37,355,494 - 37,511,125 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 20 37,337,055 - 37,345,854 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 20 37,705,626 - 37,714,425 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 20 37,705,621 - 37,786,632 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 20 37,069,579 - 37,078,375 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 20 37,478,238 - 37,487,043 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 20 37,762,923 - 37,771,723 (+) NCBI UU_Cfam_GSD_1.0
Bap1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 170,100,437 - 170,109,229 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936473 3,239,010 - 3,247,806 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936473 3,239,009 - 3,247,806 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
BAP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 34,544,581 - 34,553,483 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 34,544,570 - 34,553,538 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 37,758,317 - 37,767,182 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
BAP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 22 13,765,510 - 13,774,866 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 22 13,764,686 - 13,774,740 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 153,126,822 - 153,136,184 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Bap1
.
Predicted Target Of
Count of predictions: 136 Count of miRNA genes: 109 Interacting mature miRNAs: 115 Transcripts: ENSRNOT00000025853 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
631561 Hcuc2 Hepatic copper content QTL 2 2.8 liver copper amount (VT:0003065) liver total copper weight (CMO:0001507) 16 1 39533949 Rat 1582235 Insul8 Insulin level QTL 8 3.3 0.0063 blood insulin amount (VT:0001560) calculated serum insulin level (CMO:0000359) 16 1 26727669 Rat 2307172 Activ4 Activity QTL 4 3.71 0.00023 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 16 1 33418960 Rat 1354584 Despr6 Despair related QTL 6 3.1 0.0067 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 39533930 Rat 1357403 Slep4 Serum leptin concentration QTL 4 3.91 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 1 9639137 Rat 2302380 Slep6 Serum leptin concentration QTL 6 3.36 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 1 32139025 Rat 737819 Hcas4 Hepatocarcinoma susceptibility QTL 4 4.43 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 16 4227609 46975965 Rat 9590151 Scort8 Serum corticosterone level QTL 8 8.45 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 16 1 30836262 Rat 1354625 Despr7 Despair related QTL 7 3.16 0.016 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 44977551 Rat 61338 Bp23 Blood pressure QTL 23 4.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 4227609 49227609 Rat 61405 Niddm6 Non-insulin dependent diabetes mellitus QTL 6 3.66 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 16 4227609 48972724 Rat 631830 Alc7 Alcohol consumption QTL 7 2.9 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 1 26727669 Rat 7411664 Foco30 Food consumption QTL 30 11 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 16 1 44588133 Rat 1600378 Arunc4 Aerobic running capacity QTL 4 0.03 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 380245 80345693 Rat 70183 BpQTLcluster13 Blood pressure QTL cluster 13 3.654 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 16 4227609 43025077 Rat 1600369 Hcas8 Hepatocarcinoma susceptibility QTL 8 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 16 1 22477621 Rat 737826 Alc11 Alcohol consumption QTL 11 3.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 60252231 Rat 737825 Alc13 Alcohol consumption QTL 13 4.5 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 16039848 Rat 2303566 Bw90 Body weight QTL 90 2 body mass (VT:0001259) body weight (CMO:0000012) 16 1 39533930 Rat 2312663 Slep9 Serum leptin concentration QTL 9 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 832236 59492508 Rat 2306902 Bp339 Blood pressure QTL 339 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 3380150 43025077 Rat 1300133 Rf24 Renal function QTL 24 3.64 blood creatinine amount (VT:0005328) creatinine clearance (CMO:0000765) 16 3380150 21361552 Rat 2312660 Bw95 Body weight QTL 95 0.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 16 832236 59492508 Rat 2312666 Insul16 Insulin level QTL 16 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 16 832236 59492508 Rat 634355 Rends4 Renal damage susceptibility QTL 4 0.05 kidney blood vessel morphology trait (VT:0000530) organ lesion measurement (CMO:0000677) 16 1 26727669 Rat 61372 Bp40 Blood pressure QTL 40 2.2 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 16 4227730 17696785 Rat 2293343 Glom16 Glomerulus QTL 16 7.4 kidney glomerulus integrity trait (VT:0010546) kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269) 16 832236 46053497 Rat 2301406 Kidm39 Kidney mass QTL 39 0.002 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 16 2851709 15884239 Rat 6903319 Bw114 Body weight QTL 114 2.7 0.0037 body mass (VT:0001259) body weight (CMO:0000012) 16 1 43534949 Rat 2312669 Stl23 Serum triglyceride level QTL 23 0.01 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 16 832236 59492508 Rat
RH131028
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 66,127,306 - 66,127,492 (-) MAPPER mRatBN7.2 mRatBN7.2 8 66,127,306 - 66,127,492 (+) MAPPER mRatBN7.2 mRatBN7.2 16 6,455,221 - 6,455,407 (-) MAPPER mRatBN7.2 mRatBN7.2 16 6,455,221 - 6,455,407 (+) MAPPER mRatBN7.2 Rnor_6.0 8 71,140,995 - 71,141,180 NCBI Rnor6.0 Rnor_6.0 16 7,345,198 - 7,345,383 NCBI Rnor6.0 Rnor_5.0 16 7,273,588 - 7,273,773 UniSTS Rnor5.0 Rnor_5.0 8 70,826,934 - 70,827,119 UniSTS Rnor5.0 Celera 8 65,520,737 - 65,520,922 UniSTS Celera 16 8,733,626 - 8,733,811 UniSTS Cytogenetic Map 16 p16 UniSTS
RH143362
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 5 62,230,627 - 62,230,851 (+) MAPPER mRatBN7.2 mRatBN7.2 16 6,446,471 - 6,446,695 (+) MAPPER mRatBN7.2 Rnor_6.0 16 7,336,448 - 7,336,671 NCBI Rnor6.0 Rnor_6.0 5 63,649,645 - 63,649,868 NCBI Rnor6.0 Rnor_5.0 16 7,264,838 - 7,265,061 UniSTS Rnor5.0 Rnor_5.0 5 68,166,750 - 68,166,973 UniSTS Rnor5.0 RGSC_v3.4 16 6,684,233 - 6,684,456 UniSTS RGSC3.4 RGSC_v3.4 5 64,581,480 - 64,581,703 UniSTS RGSC3.4 Celera 5 65,364,011 - 65,364,234 UniSTS Celera 16 8,742,338 - 8,742,561 UniSTS Cytogenetic Map 16 p16 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000025853 ⟹ ENSRNOP00000025853
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 6,446,709 - 6,455,535 (+) Ensembl Rnor_6.0 Ensembl 16 7,336,685 - 7,345,511 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000108732 ⟹ ENSRNOP00000080792
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 6,447,007 - 6,455,474 (+) Ensembl
RefSeq Acc Id:
NM_001107292 ⟹ NP_001100762
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 6,453,126 - 6,461,952 (+) NCBI mRatBN7.2 16 6,446,709 - 6,455,535 (+) NCBI Rnor_6.0 16 7,336,685 - 7,345,511 (+) NCBI Rnor_5.0 16 7,265,075 - 7,273,901 (+) NCBI RGSC_v3.4 16 6,684,470 - 6,693,296 (+) RGD Celera 16 8,733,498 - 8,742,324 (-) RGD
Sequence:
GCGGCCGCCCCGCGCGGTGACTGCGCCGTCGAAGGAGGCGAGCGCGCTAACGGGGGATGGGTCACGCGGACTGTGGCCCGCGGGCACCTCAGCGTTGCAGACAGTTGTCAAAACGGGGACCGCTAACG
hide sequence
RefSeq Acc Id:
XM_006252606 ⟹ XP_006252668
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 6,453,426 - 6,461,949 (+) NCBI mRatBN7.2 16 6,446,968 - 6,455,532 (+) NCBI Rnor_6.0 16 7,336,963 - 7,345,508 (+) NCBI Rnor_5.0 16 7,265,075 - 7,273,901 (+) NCBI
Sequence:
GTGACGCGGCGCGGCCCGTTGTCTGTGTGGGGCTGAGAAGCCCCGAGGGCGGTGGGCGCTCCCG
hide sequence
RefSeq Acc Id:
XM_006252607 ⟹ XP_006252669
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 6,453,426 - 6,461,949 (+) NCBI mRatBN7.2 16 6,446,987 - 6,455,532 (+) NCBI Rnor_6.0 16 7,336,963 - 7,345,508 (+) NCBI Rnor_5.0 16 7,265,075 - 7,273,901 (+) NCBI
Sequence:
GTGACGCGGCGCGGCCCGTTGTCTGTGTGGGGCTGAGAAGCCCCGAGGGCGGTGGGCGCTCCCG
hide sequence
RefSeq Acc Id:
NP_001100762 ⟸ NM_001107292
- UniProtKB:
A0A0A0MXZ5 (UniProtKB/TrEMBL), A0A8I5ZQV2 (UniProtKB/TrEMBL)
- Sequence:
MNKGWLELESDPGLFTLLVEDFGKNPFTPDRRALAGVKGVQVEEIYDLQSKCQGPVYGFIFLFKWIEERRSRRKVSTLVDDTSVIDDDIVNSMFFAHQLIPNSCATHALLSVLLNCSNVDLGPTLSRM
hide sequence
RefSeq Acc Id:
XP_006252668 ⟸ XM_006252606
- Peptide Label:
isoform X1
- UniProtKB:
D3ZHS6 (UniProtKB/Swiss-Prot), A0A8I5ZQV2 (UniProtKB/TrEMBL)
- Sequence:
MNKGWLELESDPGLFTLLVEDFGVKGVQVEEIYDLQSKCQGPVYGFIFLFKWIEERRSRRKVSTLVDDTSVIDDDIVNSMFFAHQLIPNSCATHALLSVLLNCSNVDLGPTLSRMKDFTKGFSPESKG
hide sequence
RefSeq Acc Id:
XP_006252669 ⟸ XM_006252607
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZQV2 (UniProtKB/TrEMBL)
- Sequence:
MNKGWLELESDPGLFTLLVEDFGVKGVQVEEIYDLQSKCQGPVYGFIFLFKWIEERRSRRKVSTLVDDTSVIDDDIVNSMFFAHQLIPNSCATHALLSVLLNCSNVDLGPTLSRMKDFTKGFSPESKG
hide sequence
Ensembl Acc Id:
ENSRNOP00000025853 ⟸ ENSRNOT00000025853
Ensembl Acc Id:
ENSRNOP00000080792 ⟸ ENSRNOT00000108732
RGD ID: 13699929 Promoter ID: EPDNEW_R10452 Type: single initiation site Name: Bap1_2 Description: Brca1 associated protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_R10453 Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 16 7,336,605 - 7,336,665 EPDNEW
RGD ID: 13699930 Promoter ID: EPDNEW_R10453 Type: initiation region Name: Bap1_1 Description: Brca1 associated protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_R10452 Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 16 7,336,989 - 7,337,049 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2024-07-19
Bap1
BRCA1 associated deubiquitinase 1
Bap1
Brca1 associated protein 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2015-11-25
Bap1
Brca1 associated protein 1
Bap1
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-09-25
Bap1
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Bap1
Brca1 associated protein 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Bap1
Brca1 associated protein 1
Bap1_predicted
Brca1 associated protein 1 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Bap1_predicted
Brca1 associated protein 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
