Symbol:
Rras
Name:
RAS related
RGD ID:
1311443
Description:
Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Predicted to be involved in several processes, including face morphogenesis; positive regulation of endothelial cell-matrix adhesion via fibronectin; and regulation of intracellular signal transduction. Predicted to act upstream of or within negative regulation of Schwann cell migration. Predicted to be active in plasma membrane. Orthologous to human RRAS (RAS related); PARTICIPATES IN ephrin - ephrin receptor bidirectional signaling axis; mitogen activated protein kinase signaling pathway; INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
Harvey rat sarcoma oncogene, subgroup R; Harvey rat sarcoma virus oncogene, subgroup R; LOC361568; p23; ras-related protein R-Ras; Ras-related protein R-RAS (P23); RAS-related viral oncoprotein; related RAS viral (r-ras) oncogene homolog
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
RRAS (RAS related) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Rras (related RAS viral (r-ras) oncogene) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Rras (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
RRAS (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
RRAS (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Rras (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
RRAS (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
RRAS (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Rras (RAS related) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
LPO (lactoperoxidase) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
RRAS (RAS related)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Rras (related RAS viral (r-ras) oncogene)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
rras (RAS related)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB)
Saccharomyces cerevisiae (baker's yeast):
RAS1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
Ras64B
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER|PhylomeDB)
Caenorhabditis elegans (roundworm):
ras-1
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
RAS2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
rras
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 104,637,061 - 104,640,841 (+) NCBI GRCr8 mRatBN7.2 1 95,500,582 - 95,504,362 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 95,500,566 - 95,504,357 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 100,885,980 - 100,889,760 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 109,358,646 - 109,362,426 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 102,649,041 - 102,652,821 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 101,012,822 - 101,016,720 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 101,012,822 - 101,016,720 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 102,077,775 - 102,081,673 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 95,490,730 - 95,495,462 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 95,568,807 - 95,573,563 (+) NCBI Celera 1 89,761,925 - 89,765,705 (+) NCBI Celera Cytogenetic Map 1 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rras Rat (-)-alpha-phellandrene increases expression ISO RRAS (Homo sapiens) 6480464 alpha phellandrene results in increased expression of RRAS mRNA CTD PMID:25075043 Rras Rat (1->4)-beta-D-glucan multiple interactions ISO Rras (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of RRAS mRNA CTD PMID:36331819 Rras Rat 1,1-dichloroethene increases expression ISO Rras (Mus musculus) 6480464 vinylidene chloride results in increased expression of RRAS mRNA CTD PMID:26682919 Rras Rat 1-naphthyl isothiocyanate increases expression EXP 6480464 1-Naphthylisothiocyanate results in increased expression of RRAS mRNA CTD PMID:30723492 Rras Rat 17beta-estradiol decreases expression ISO RRAS (Homo sapiens) 6480464 Estradiol results in decreased expression of RRAS mRNA CTD PMID:16029874 Rras Rat 17beta-estradiol multiple interactions ISO RRAS (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in increased expression of RRAS mRNA CTD PMID:30165855 Rras Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Rras (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of RRAS mRNA CTD PMID:21570461 Rras Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of RRAS mRNA CTD PMID:33387578 and PMID:34747641 Rras Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RRAS (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of RRAS mRNA CTD PMID:20106945 and PMID:21632981 Rras Rat 2,6-dimethoxyphenol multiple interactions ISO RRAS (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1 and 3-dimethyl ether] results in increased expression of and affects the localization of RRAS protein CTD PMID:38598786 Rras Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of RRAS protein CTD PMID:34915118 Rras Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Rras (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of RRAS mRNA CTD PMID:16054899 Rras Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO RRAS (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RRAS mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RRAS mRNA CTD PMID:28628672 Rras Rat 4-hydroxyphenyl retinamide decreases expression ISO Rras (Mus musculus) 6480464 Fenretinide results in decreased expression of RRAS mRNA CTD PMID:16467112 and PMID:28973697 Rras Rat 5-aza-2'-deoxycytidine affects expression ISO RRAS (Homo sapiens) 6480464 Decitabine affects the expression of RRAS mRNA CTD PMID:23300844 Rras Rat 5-fluorouracil affects response to substance ISO RRAS (Homo sapiens) 6480464 RRAS protein affects the susceptibility to Fluorouracil CTD PMID:16217747 Rras Rat aconitine increases expression EXP 6480464 Aconitine results in increased expression of RRAS protein CTD PMID:33236894 Rras Rat actinomycin D increases expression ISO RRAS (Homo sapiens) 6480464 Dactinomycin results in increased expression of RRAS mRNA CTD PMID:21527772 Rras Rat aflatoxin B1 increases expression ISO RRAS (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of RRAS mRNA CTD PMID:21527772 and PMID:27153756 Rras Rat all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of RRAS mRNA CTD PMID:20488242 Rras Rat all-trans-retinoic acid increases expression ISO RRAS (Homo sapiens) 6480464 Tretinoin results in increased expression of RRAS mRNA CTD PMID:23724009 Rras Rat alpha-phellandrene increases expression ISO RRAS (Homo sapiens) 6480464 alpha phellandrene results in increased expression of RRAS mRNA CTD PMID:25075043 Rras Rat aristolochic acid A decreases expression ISO RRAS (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of RRAS mRNA CTD PMID:33212167 Rras Rat arsane increases methylation ISO RRAS (Homo sapiens) 6480464 Arsenic results in increased methylation of RRAS gene CTD PMID:24525453 Rras Rat arsenic atom increases methylation ISO RRAS (Homo sapiens) 6480464 Arsenic results in increased methylation of RRAS gene CTD PMID:24525453 Rras Rat arsenous acid increases expression ISO RRAS (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of RRAS mRNA CTD PMID:20458559 Rras Rat atrazine increases expression ISO RRAS (Homo sapiens) 6480464 Atrazine results in increased expression of RRAS mRNA CTD PMID:22378314 Rras Rat benzo[a]pyrene increases expression ISO RRAS (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of RRAS mRNA CTD PMID:20106945 Rras Rat benzo[a]pyrene affects methylation ISO RRAS (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of RRAS 3' UTR CTD PMID:27901495 Rras Rat benzo[a]pyrene increases expression ISO Rras (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of RRAS mRNA CTD PMID:22228805 Rras Rat benzo[a]pyrene decreases expression ISO Rras (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of RRAS mRNA CTD PMID:19770486 and PMID:21715664 Rras Rat bis(2-ethylhexyl) phthalate decreases expression ISO Rras (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of RRAS mRNA CTD PMID:33754040 Rras Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RRAS mRNA CTD PMID:25181051 Rras Rat bisphenol A decreases expression ISO Rras (Mus musculus) 6480464 bisphenol A results in decreased expression of RRAS mRNA CTD PMID:33221593 Rras Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of RRAS gene CTD PMID:28505145 Rras Rat bisphenol A multiple interactions ISO RRAS (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RRAS mRNA and [Phenolsulfonphthalein deficiency co-treated with bisphenol A deficiency] results in increased expression of RRAS protein CTD PMID:28628672 and PMID:31629898 Rras Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of RRAS mRNA CTD PMID:30816183 more ... Rras Rat bisphenol AF increases expression ISO RRAS (Homo sapiens) 6480464 bisphenol AF results in increased expression of RRAS protein CTD PMID:34186270 Rras Rat Bisphenol B increases expression ISO RRAS (Homo sapiens) 6480464 bisphenol B results in increased expression of RRAS protein CTD PMID:34186270 Rras Rat bisphenol F multiple interactions ISO RRAS (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RRAS mRNA CTD PMID:28628672 Rras Rat bisphenol F increases expression ISO RRAS (Homo sapiens) 6480464 bisphenol F results in increased expression of RRAS protein CTD PMID:34186270 Rras Rat bisphenol F decreases expression ISO Rras (Mus musculus) 6480464 bisphenol F results in decreased expression of RRAS mRNA CTD PMID:38685157 Rras Rat butyric acid increases expression ISO RRAS (Homo sapiens) 6480464 Butyric Acid results in increased expression of RRAS mRNA CTD PMID:34581912 Rras Rat cadmium dichloride increases methylation EXP 6480464 Cadmium Chloride results in increased methylation of RRAS promoter CTD PMID:22457795 Rras Rat calcitriol multiple interactions ISO RRAS (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of RRAS mRNA CTD PMID:21592394 Rras Rat calcitriol increases expression ISO RRAS (Homo sapiens) 6480464 Calcitriol results in increased expression of RRAS mRNA CTD PMID:21592394 Rras Rat chlordecone decreases expression ISO Rras (Mus musculus) 6480464 Chlordecone results in decreased expression of RRAS mRNA CTD PMID:33711761 Rras Rat chlorpyrifos increases expression ISO Rras (Mus musculus) 6480464 Chlorpyrifos results in increased expression of RRAS mRNA CTD PMID:37019170 Rras Rat cisplatin increases expression ISO Rras (Mus musculus) 6480464 Cisplatin results in increased expression of RRAS mRNA CTD PMID:21151649 Rras Rat cisplatin affects expression ISO RRAS (Homo sapiens) 6480464 Cisplatin affects the expression of RRAS mRNA CTD PMID:23300844 Rras Rat clofibrate decreases expression ISO Rras (Mus musculus) 6480464 Clofibrate results in decreased expression of RRAS mRNA CTD PMID:17585979 Rras Rat clofibrate multiple interactions ISO Rras (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of RRAS mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of RRAS mRNA] CTD PMID:17585979 Rras Rat cobalt dichloride decreases expression ISO RRAS (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of RRAS mRNA CTD PMID:19320972 and PMID:19376846 Rras Rat copper atom multiple interactions ISO RRAS (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of RRAS mRNA and [Disulfiram binds to Copper] which results in increased expression of RRAS mRNA CTD PMID:24690739 and PMID:30911355 Rras Rat copper(0) multiple interactions ISO RRAS (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of RRAS mRNA and [Disulfiram binds to Copper] which results in increased expression of RRAS mRNA CTD PMID:24690739 and PMID:30911355 Rras Rat crocidolite asbestos affects expression ISO RRAS (Homo sapiens) 6480464 Asbestos and Crocidolite affects the expression of RRAS mRNA CTD PMID:17331233 Rras Rat cyclosporin A increases expression ISO RRAS (Homo sapiens) 6480464 Cyclosporine results in increased expression of RRAS mRNA CTD PMID:25562108 Rras Rat cyproconazole increases expression ISO Rras (Mus musculus) 6480464 cyproconazole results in increased expression of RRAS mRNA CTD PMID:22334560 Rras Rat cytarabine decreases expression ISO RRAS (Homo sapiens) 6480464 Cytarabine results in decreased expression of RRAS mRNA CTD PMID:21198554 Rras Rat dexamethasone multiple interactions ISO Rras (Mus musculus) 6480464 [Dexamethasone co-treated with rosiglitazone co-treated with 1-Methyl-3-isobutylxanthine co-treated with INS1 protein] results in decreased expression of RRAS mRNA CTD PMID:16054899 Rras Rat dexamethasone multiple interactions ISO RRAS (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RRAS mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RRAS mRNA CTD PMID:28628672 Rras Rat diarsenic trioxide increases expression ISO RRAS (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of RRAS mRNA CTD PMID:20458559 Rras Rat Dibutyl phosphate affects expression ISO RRAS (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RRAS mRNA CTD PMID:37042841 Rras Rat dibutyl phthalate increases expression ISO Rras (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of RRAS mRNA CTD PMID:21266533 Rras Rat dioxygen increases expression ISO RRAS (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of RRAS mRNA CTD PMID:17914565 Rras Rat disulfiram multiple interactions ISO RRAS (Homo sapiens) 6480464 [Disulfiram binds to Copper] which results in increased expression of RRAS mRNA CTD PMID:24690739 Rras Rat diuron increases expression EXP 6480464 Diuron results in increased expression of RRAS mRNA CTD PMID:21551480 Rras Rat dorsomorphin multiple interactions ISO RRAS (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAS mRNA CTD PMID:27188386 Rras Rat entinostat increases expression ISO RRAS (Homo sapiens) 6480464 entinostat results in increased expression of RRAS mRNA CTD PMID:27188386 Rras Rat epoxiconazole increases expression ISO Rras (Mus musculus) 6480464 epoxiconazole results in increased expression of RRAS mRNA CTD PMID:22334560 Rras Rat epoxiconazole decreases expression ISO Rras (Mus musculus) 6480464 epoxiconazole results in decreased expression of RRAS mRNA CTD PMID:35436446 Rras Rat etoposide increases expression ISO RRAS (Homo sapiens) 6480464 Etoposide results in increased expression of RRAS mRNA CTD PMID:21527772 Rras Rat ferrosoferric oxide multiple interactions ISO RRAS (Homo sapiens) 6480464 [Ferrosoferric Oxide binds to titanium dioxide] which results in increased expression of RRAS protein CTD PMID:30098274 Rras Rat furfural multiple interactions ISO RRAS (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of RRAS protein CTD PMID:38598786 Rras Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of RRAS mRNA CTD PMID:33387578 Rras Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of RRAS mRNA CTD PMID:24136188 Rras Rat glyphosate increases expression ISO RRAS (Homo sapiens) 6480464 Glyphosate results in increased expression of RRAS mRNA CTD PMID:31295307 Rras Rat hydroxyurea increases expression ISO Rras (Mus musculus) 6480464 Hydroxyurea results in increased expression of RRAS mRNA CTD PMID:12929121 Rras Rat indometacin multiple interactions ISO RRAS (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of RRAS mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of RRAS mRNA CTD PMID:28628672 Rras Rat inulin multiple interactions ISO Rras (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of RRAS mRNA CTD PMID:36331819 Rras Rat ivermectin decreases expression ISO RRAS (Homo sapiens) 6480464 Ivermectin results in decreased expression of RRAS protein CTD PMID:32959892 Rras Rat lipopolysaccharide decreases expression ISO Rras (Mus musculus) 6480464 Lipopolysaccharides results in decreased expression of RRAS mRNA CTD PMID:12057914 Rras Rat lipopolysaccharide multiple interactions ISO RRAS (Homo sapiens) 6480464 [NAT10 protein affects the susceptibility to Lipopolysaccharides] which affects the expression of RRAS mRNA CTD PMID:35877022 Rras Rat lipopolysaccharide increases expression ISO Rras (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of RRAS mRNA CTD PMID:27339419 Rras Rat mercury dibromide decreases expression ISO RRAS (Homo sapiens) 6480464 mercuric bromide results in decreased expression of RRAS mRNA CTD PMID:26272509 Rras Rat mercury dibromide multiple interactions ISO RRAS (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAS mRNA CTD PMID:27188386 Rras Rat methotrexate increases expression ISO RRAS (Homo sapiens) 6480464 Methotrexate results in increased expression of RRAS mRNA CTD PMID:21678067 Rras Rat N-methyl-4-phenylpyridinium increases expression ISO RRAS (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of RRAS mRNA CTD PMID:24810058 Rras Rat N-nitrosodiethylamine increases expression ISO RRAS (Homo sapiens) 6480464 Diethylnitrosamine results in increased expression of RRAS mRNA CTD PMID:21527772 Rras Rat p-anisidine increases expression ISO Rras (Mus musculus) 6480464 4-anisidine results in increased expression of RRAS mRNA CTD PMID:12929121 Rras Rat paracetamol multiple interactions ISO Rras (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of RRAS mRNA more ... CTD PMID:17585979 and PMID:29246445 Rras Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of RRAS mRNA CTD PMID:33387578 Rras Rat paracetamol increases expression ISO Rras (Mus musculus) 6480464 Acetaminophen results in increased expression of RRAS mRNA CTD PMID:29246445 Rras Rat paracetamol increases expression ISO RRAS (Homo sapiens) 6480464 Acetaminophen results in increased expression of RRAS mRNA CTD PMID:22230336 Rras Rat paracetamol affects expression ISO Rras (Mus musculus) 6480464 Acetaminophen affects the expression of RRAS mRNA CTD PMID:17562736 Rras Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Rras (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of RRAS mRNA more ... CTD PMID:36331819 Rras Rat phenobarbital multiple interactions ISO Rras (Mus musculus) 6480464 NR1I3 protein promotes the reaction [Phenobarbital results in increased expression of RRAS mRNA] CTD PMID:19482888 Rras Rat phenobarbital increases expression ISO Rras (Mus musculus) 6480464 Phenobarbital results in increased expression of RRAS mRNA CTD PMID:19482888 Rras Rat phenol red multiple interactions ISO RRAS (Homo sapiens) 6480464 [Phenolsulfonphthalein deficiency co-treated with bisphenol A deficiency] results in increased expression of RRAS protein CTD PMID:31629898 Rras Rat potassium chromate decreases expression ISO RRAS (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of RRAS mRNA CTD PMID:22714537 Rras Rat propiconazole increases expression ISO Rras (Mus musculus) 6480464 propiconazole results in increased expression of RRAS mRNA CTD PMID:22334560 Rras Rat quercetin increases expression ISO RRAS (Homo sapiens) 6480464 Quercetin results in increased expression of RRAS mRNA CTD PMID:21632981 Rras Rat raloxifene affects expression ISO RRAS (Homo sapiens) 6480464 Raloxifene Hydrochloride affects the expression of RRAS mRNA CTD PMID:14699072 Rras Rat SB 431542 multiple interactions ISO RRAS (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAS mRNA CTD PMID:27188386 Rras Rat sodium arsenite decreases expression ISO RRAS (Homo sapiens) 6480464 sodium arsenite results in decreased expression of RRAS protein CTD PMID:24431212 Rras Rat sodium arsenite increases expression ISO RRAS (Homo sapiens) 6480464 sodium arsenite results in increased expression of RRAS protein CTD PMID:24431212 Rras Rat sodium chloride multiple interactions ISO RRAS (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of RRAS protein more ... CTD PMID:38598786 Rras Rat sodium fluoride increases expression ISO Rras (Mus musculus) 6480464 Sodium Fluoride results in increased expression of RRAS protein CTD PMID:28918527 Rras Rat Soman increases expression EXP 6480464 Soman results in increased expression of RRAS mRNA CTD PMID:19281266 Rras Rat sunitinib decreases expression ISO RRAS (Homo sapiens) 6480464 Sunitinib results in decreased expression of RRAS mRNA CTD PMID:31533062 Rras Rat temozolomide decreases expression ISO RRAS (Homo sapiens) 6480464 Temozolomide results in decreased expression of RRAS mRNA CTD PMID:31758290 Rras Rat testosterone multiple interactions ISO RRAS (Homo sapiens) 6480464 [Testosterone co-treated with Calcitriol] results in increased expression of RRAS mRNA CTD PMID:21592394 Rras Rat testosterone increases expression ISO RRAS (Homo sapiens) 6480464 Testosterone results in increased expression of RRAS mRNA CTD PMID:21592394 Rras Rat tetrachloromethane increases expression ISO Rras (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of RRAS mRNA CTD PMID:31919559 Rras Rat thalidomide decreases expression ISO Rras (Mus musculus) 6480464 Thalidomide results in decreased expression of RRAS mRNA CTD PMID:26006729 and PMID:26217789 Rras Rat thiram decreases expression ISO RRAS (Homo sapiens) 6480464 Thiram results in decreased expression of RRAS mRNA CTD PMID:38568856 Rras Rat titanium dioxide increases expression ISO RRAS (Homo sapiens) 6480464 titanium dioxide results in increased expression of RRAS protein CTD PMID:30098274 Rras Rat titanium dioxide multiple interactions ISO RRAS (Homo sapiens) 6480464 [Ferrosoferric Oxide binds to titanium dioxide] which results in increased expression of RRAS protein CTD PMID:30098274 Rras Rat tris(2-butoxyethyl) phosphate affects expression ISO RRAS (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate affects the expression of RRAS mRNA CTD PMID:29024780 Rras Rat valproic acid increases methylation ISO RRAS (Homo sapiens) 6480464 Valproic Acid results in increased methylation of RRAS gene CTD PMID:29154799 Rras Rat valproic acid affects expression ISO RRAS (Homo sapiens) 6480464 Valproic Acid affects the expression of RRAS mRNA CTD PMID:25979313 Rras Rat valproic acid increases expression ISO RRAS (Homo sapiens) 6480464 Valproic Acid results in increased expression of RRAS mRNA CTD PMID:19101580 Rras Rat vancomycin decreases expression ISO Rras (Mus musculus) 6480464 Vancomycin results in decreased expression of RRAS mRNA CTD PMID:18930951 Rras Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of RRAS mRNA CTD PMID:23034163 Rras Rat vorinostat decreases expression ISO RRAS (Homo sapiens) 6480464 vorinostat results in decreased expression of RRAS protein CTD PMID:20543569 Rras Rat XL147 multiple interactions ISO Rras (Mus musculus) 6480464 XL147 inhibits the reaction [N-nitroso-tris-chloroethylurea results in increased expression of RRAS mRNA] CTD PMID:29891994
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(-)-alpha-phellandrene (ISO) (1->4)-beta-D-glucan (ISO) 1,1-dichloroethene (ISO) 1-naphthyl isothiocyanate (EXP) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (ISO) 5-fluorouracil (ISO) aconitine (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP,ISO) alpha-phellandrene (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) atrazine (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) butyric acid (ISO) cadmium dichloride (EXP) calcitriol (ISO) chlordecone (ISO) chlorpyrifos (ISO) cisplatin (ISO) clofibrate (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) cyproconazole (ISO) cytarabine (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dioxygen (ISO) disulfiram (ISO) diuron (EXP) dorsomorphin (ISO) entinostat (ISO) epoxiconazole (ISO) etoposide (ISO) ferrosoferric oxide (ISO) furfural (ISO) gentamycin (EXP) glafenine (EXP) glyphosate (ISO) hydroxyurea (ISO) indometacin (ISO) inulin (ISO) ivermectin (ISO) lipopolysaccharide (ISO) mercury dibromide (ISO) methotrexate (ISO) N-methyl-4-phenylpyridinium (ISO) N-nitrosodiethylamine (ISO) p-anisidine (ISO) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) phenol red (ISO) potassium chromate (ISO) propiconazole (ISO) quercetin (ISO) raloxifene (ISO) SB 431542 (ISO) sodium arsenite (ISO) sodium chloride (ISO) sodium fluoride (ISO) Soman (EXP) sunitinib (ISO) temozolomide (ISO) testosterone (ISO) tetrachloromethane (ISO) thalidomide (ISO) thiram (ISO) titanium dioxide (ISO) tris(2-butoxyethyl) phosphate (ISO) valproic acid (ISO) vancomycin (ISO) vinclozolin (EXP) vorinostat (ISO) XL147 (ISO)
Biological Process
cell migration (IEA,ISO) face morphogenesis (IEA,ISO) leukocyte differentiation (IEA,ISO) negative regulation of Schwann cell migration (IEA,ISO) positive regulation of angiogenesis (IEA,ISO,ISS) positive regulation of endothelial cell migration (IEA,ISO) positive regulation of endothelial cell-matrix adhesion via fibronectin (IEA,ISO) positive regulation of vasculogenesis (IEA,ISO) regulation of ERK1 and ERK2 cascade (IEA,ISO) regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (IEA,ISO) Schwann cell migration (IEA,ISO) signal transduction (IEA)
Rras Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 104,637,061 - 104,640,841 (+) NCBI GRCr8 mRatBN7.2 1 95,500,582 - 95,504,362 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 95,500,566 - 95,504,357 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 100,885,980 - 100,889,760 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 109,358,646 - 109,362,426 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 102,649,041 - 102,652,821 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 101,012,822 - 101,016,720 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 101,012,822 - 101,016,720 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 102,077,775 - 102,081,673 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 95,490,730 - 95,495,462 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 95,568,807 - 95,573,563 (+) NCBI Celera 1 89,761,925 - 89,765,705 (+) NCBI Celera Cytogenetic Map 1 q22 NCBI
RRAS Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 49,635,292 - 49,640,143 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 49,635,292 - 49,640,143 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 50,138,549 - 50,143,400 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 54,830,364 - 54,835,212 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 19 54,830,363 - 54,835,212 NCBI Celera 19 47,007,883 - 47,012,731 (-) NCBI Celera Cytogenetic Map 19 q13.33 NCBI HuRef 19 46,515,612 - 46,520,460 (-) NCBI HuRef CHM1_1 19 50,140,333 - 50,145,181 (-) NCBI CHM1_1 T2T-CHM13v2.0 19 52,635,325 - 52,640,178 (-) NCBI T2T-CHM13v2.0
Rras Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 44,665,686 - 44,671,070 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 44,667,385 - 44,671,071 (+) Ensembl GRCm39 Ensembl GRCm38 7 45,017,942 - 45,021,646 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 45,017,961 - 45,021,647 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 52,273,377 - 52,277,014 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 44,886,049 - 44,889,686 (+) NCBI MGSCv36 mm8 Celera 7 40,469,567 - 40,473,202 (+) NCBI Celera Cytogenetic Map 7 B3 NCBI cM Map 7 29.08 NCBI
Rras Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955559 1,244,658 - 1,248,774 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955559 1,244,658 - 1,248,774 (+) NCBI ChiLan1.0 ChiLan1.0
RRAS Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 55,752,559 - 55,757,421 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 57,673,302 - 57,678,161 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 19 46,649,892 - 46,654,754 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 19 55,569,465 - 55,571,444 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 19 55,569,749 - 55,573,721 (-) Ensembl panpan1.1 panPan2
RRAS Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 106,895,413 - 106,899,265 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 106,895,408 - 106,899,222 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 106,479,192 - 106,483,049 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 107,416,876 - 107,420,728 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 107,416,878 - 107,420,685 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 107,089,085 - 107,092,934 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 106,731,174 - 106,735,018 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 107,572,304 - 107,576,157 (+) NCBI UU_Cfam_GSD_1.0
Rras Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409349 21,838,491 - 21,842,354 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936664 3,456,290 - 3,460,788 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936664 3,456,681 - 3,460,537 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
RRAS Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 54,680,600 - 54,684,719 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 54,680,596 - 54,684,714 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 50,409,620 - 50,413,729 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
RRAS Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 42,810,411 - 42,815,504 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 42,810,339 - 42,815,479 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666073 22,754,154 - 22,759,266 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Rras
.
Predicted Target Of
Count of predictions: 59 Count of miRNA genes: 55 Interacting mature miRNAs: 59 Transcripts: ENSRNOT00000027809 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
2313059 Bss55 Bone structure and strength QTL 55 3.2 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 70209 Niddm23 Non-insulin dependent diabetes mellitus QTL 23 2.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 94494440 198324465 Rat 631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1582234 Gluco18 Glucose level QTL 18 3.4 0.0003 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 78479925 123479925 Rat 1358359 Sradr1 Stress Responsive Adrenal Weight QTL 1 4.74 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 30882023 123479925 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 1331793 Bp200 Blood pressure QTL 200 3.71601 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94494440 172949803 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 2300324 Fetw1 Fetal weight QTL 1 12.1 0.005 fetal growth trait (VT:0004201) fetal body weight (CMO:0002080) 1 85424647 100358001 Rat 1300121 Hrtrt1 Heart rate QTL 1 3.7 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 65789093 115540829 Rat 1331800 Scl25 Serum cholesterol level QTL 25 3.013 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 1 94494440 117601394 Rat 7421628 Bp361 Blood pressure QTL 361 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 66023617 118608521 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 2313072 Bss53 Bone structure and strength QTL 53 4.3 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 43284731 118944897 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 2313078 Bss54 Bone structure and strength QTL 54 3.5 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 1302788 Scl19 Serum cholesterol QTL 19 4.6 0.001 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 90532338 123479925 Rat 1549903 Bp267 Blood pressure QTL 267 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 77876254 106047988 Rat 2313083 Bmd74 Bone mineral density QTL 74 4 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 82174743 118944897 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 4889494 Scort2 Serum corticosterone level QTL 2 4.2 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 80592172 125592172 Rat 724567 Tcas6 Tongue tumor susceptibility QTL 6 6.85 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 1 92948896 144267916 Rat 61342 Bp27 Blood pressure QTL 27 3.4 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 56732668 98773277 Rat 61344 Bp29 Blood pressure QTL 29 7.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 78350581 123350581 Rat 724521 Uae1 Urinary albumin excretion QTL 1 3.8 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 90508614 173018436 Rat 1358902 Bw47 Body weight QTL 47 1.67 body mass (VT:0001259) body weight (CMO:0000012) 1 90508614 180359386 Rat 1358192 Ept13 Estrogen-induced pituitary tumorigenesis QTL 13 3.4 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 77494165 122494165 Rat 2313094 Bss58 Bone structure and strength QTL 58 3.7 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 43284731 118944897 Rat 2300164 Bmd44 Bone mineral density QTL 44 5.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 1 56949932 101949932 Rat 2313099 Bss56 Bone structure and strength QTL 56 2.4 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 1 43284731 118944897 Rat 2313098 Bmd70 Bone mineral density QTL 70 3.6 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 43284731 118944897 Rat 1300153 Bp171 Blood pressure QTL 171 3.37 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 90664883 143200202 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 738022 Anxrr13 Anxiety related response QTL 13 4.6 0.00039 locomotor behavior trait (VT:0001392) number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514) 1 83547917 128547917 Rat 152025249 Scl82 Serum cholesterol level QTL 82 4.77 blood cholesterol amount (VT:0000180) 1 50343510 99980958 Rat 10054135 Gmadr2 Adrenal mass QTL 2 1.97 0.0129 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 77857876 122857876 Rat 7411712 Strs4 Sensitivity to stroke QTL 4 8.7 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 1 78430536 123430536 Rat 1331749 Hrtrt11 Heart rate QTL 11 2.973 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 94494440 198211706 Rat 1331751 Bp199 Blood pressure QTL 199 3.60022 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 94494440 181830018 Rat 2293142 Bp314 Blood pressure QTL 314 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 92184926 137184926 Rat 2313051 Bss57 Bone structure and strength QTL 57 3.7 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 43284731 118944897 Rat 724529 Cm16 Cardiac mass QTL 16 2.7 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 1 87580395 150700247 Rat
Rras
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 1 104,640,630 - 104,640,761 (+) Marker Load Pipeline mRatBN7.2 1 95,504,151 - 95,504,283 (+) MAPPER mRatBN7.2 Rnor_6.0 1 101,016,510 - 101,016,641 NCBI Rnor6.0 Rnor_5.0 1 102,081,463 - 102,081,594 UniSTS Rnor5.0 RGSC_v3.4 1 95,495,252 - 95,495,383 UniSTS RGSC3.4 Celera 1 89,765,495 - 89,765,626 UniSTS Cytogenetic Map 1 q22 UniSTS
AI573426
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 95,504,077 - 95,504,195 (+) MAPPER mRatBN7.2 Rnor_6.0 1 101,016,436 - 101,016,553 NCBI Rnor6.0 Rnor_5.0 1 102,081,389 - 102,081,506 UniSTS Rnor5.0 RGSC_v3.4 1 95,495,178 - 95,495,295 UniSTS RGSC3.4 Celera 1 89,765,421 - 89,765,538 UniSTS Cytogenetic Map 1 q22 UniSTS
BF403987
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 95,501,045 - 95,501,188 (+) MAPPER mRatBN7.2 Rnor_6.0 1 101,013,286 - 101,013,428 NCBI Rnor6.0 Rnor_5.0 1 102,078,239 - 102,078,381 UniSTS Rnor5.0 RGSC_v3.4 1 95,491,194 - 95,491,335 UniSTS RGSC3.4 Celera 1 89,762,389 - 89,762,531 UniSTS Cytogenetic Map 1 q22 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000027809 ⟹ ENSRNOP00000027809
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 95,500,566 - 95,504,357 (+) Ensembl Rnor_6.0 Ensembl 1 101,012,822 - 101,016,720 (+) Ensembl
RefSeq Acc Id:
NM_001108481 ⟹ NP_001101951
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 104,637,061 - 104,640,841 (+) NCBI mRatBN7.2 1 95,500,582 - 95,504,362 (+) NCBI Rnor_6.0 1 101,012,822 - 101,016,720 (+) NCBI Rnor_5.0 1 102,077,775 - 102,081,673 (+) NCBI RGSC_v3.4 1 95,490,730 - 95,495,462 (+) RGD Celera 1 89,761,925 - 89,765,705 (+) RGD
Sequence:
GCGGTGGCGACATGAGCAGCGGGGCGGCGTCCGGGACTGGGCGGGGGCGGCCCCGGGGCGGGGGGCCGGGACCCAGGGACCCCCCGCCCGGCGAGACTCACAAGCTGGTGGTCGTAGGCGGCGGCGGC
hide sequence
RefSeq Acc Id:
XM_039082165 ⟹ XP_038938093
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 104,637,313 - 104,640,838 (+) NCBI mRatBN7.2 1 95,500,835 - 95,504,359 (+) NCBI
RefSeq Acc Id:
NP_001101951 ⟸ NM_001108481
- UniProtKB:
D3Z8L7 (UniProtKB/Swiss-Prot)
- Sequence:
MSSGAASGTGRGRPRGGGPGPRDPPPGETHKLVVVGGGGVGKSALTIQFIQSYFVSDYDPTIEDSYTKICTVDGIPARLDILDTAGQEEFGAMREQYMRAGNGFLLVFAINDRQSFIEVSKLFTQILR
hide sequence
Ensembl Acc Id:
ENSRNOP00000027809 ⟸ ENSRNOT00000027809
RefSeq Acc Id:
XP_038938093 ⟸ XM_039082165
- Peptide Label:
isoform X1
RGD ID: 13690018 Promoter ID: EPDNEW_R543 Type: initiation region Name: Rras_1 Description: RAS related SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 101,012,803 - 101,012,863 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2017-08-16
Rras
RAS related
Rras
related RAS viral (r-ras) oncogene homolog
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2011-09-29
Rras
related RAS viral (r-ras) oncogene homolog
Rras
Harvey rat sarcoma virus oncogene, subgroup R
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-11-20
Rras
Harvey rat sarcoma virus oncogene, subgroup R
Rras
Harvey rat sarcoma oncogene, subgroup R
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Rras
Harvey rat sarcoma oncogene, subgroup R
Rras_predicted
Harvey rat sarcoma oncogene, subgroup R (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Rras_predicted
Harvey rat sarcoma oncogene, subgroup R (predicted)
Symbol and Name status set to approved
70820 APPROVED
