Symbol:
Usp47
Name:
ubiquitin specific peptidase 47
RGD ID:
1310411
Description:
Predicted to enable WD40-repeat domain binding activity and cysteine-type deubiquitinase activity. Predicted to be involved in several processes, including base-excision repair; monoubiquitinated protein deubiquitination; and positive regulation of canonical Wnt signaling pathway. Predicted to act upstream of or within negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage. Predicted to be located in cytoplasm. Predicted to be part of SCF ubiquitin ligase complex. Predicted to be active in cytosol and nucleus. Orthologous to human USP47 (ubiquitin specific peptidase 47); INTERACTS WITH 1,3-dinitrobenzene; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC308896; ubiquitin carboxyl-terminal hydrolase 47; ubiquitin specific protease 47
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 175,586,758 - 175,669,904 (+) NCBI GRCr8 mRatBN7.2 1 166,152,104 - 166,235,312 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 166,152,199 - 166,235,312 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 174,487,162 - 174,570,366 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 181,673,157 - 181,756,359 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 174,373,161 - 174,456,333 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 176,854,589 - 176,937,763 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 176,854,653 - 176,937,763 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 169,836,253 - 169,920,055 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 169,947,098 - 170,039,002 (+) NCBI Celera 1 164,029,805 - 164,112,586 (+) NCBI Celera Cytogenetic Map 1 q33 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Usp47 Rat 1,2-dichloroethane decreases expression ISO Usp47 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of USP47 mRNA CTD PMID:28960355 Usp47 Rat 1,2-dimethylhydrazine affects expression ISO Usp47 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of USP47 mRNA CTD PMID:22206623 Usp47 Rat 1,3-dinitrobenzene increases expression EXP 6480464 3-dinitrobenzene results in increased expression of USP47 mRNA CTD PMID:24140754 Usp47 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Usp47 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of USP47 mRNA CTD PMID:21354282 Usp47 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of USP47 mRNA CTD PMID:33387578 Usp47 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of USP47 mRNA CTD PMID:34747641 Usp47 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Usp47 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of USP47 mRNA CTD PMID:21570461 Usp47 Rat 2,4,6-tribromophenol increases expression ISO USP47 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Usp47 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of USP47 mRNA CTD PMID:21346803 Usp47 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of USP47 mRNA CTD PMID:21346803 Usp47 Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO USP47 (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of USP47 protein CTD PMID:31675489 Usp47 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Usp47 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of USP47 mRNA CTD PMID:18648102 Usp47 Rat 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of USP47 mRNA CTD PMID:30723492 Usp47 Rat 4,4'-sulfonyldiphenol increases expression ISO Usp47 (Mus musculus) 6480464 bisphenol S results in increased expression of USP47 mRNA CTD PMID:39298647 Usp47 Rat 4,4'-sulfonyldiphenol increases methylation ISO USP47 (Homo sapiens) 6480464 bisphenol S results in increased methylation of USP47 gene CTD PMID:31601247 Usp47 Rat 4-hydroxyphenyl retinamide increases expression ISO Usp47 (Mus musculus) 6480464 Fenretinide results in increased expression of USP47 mRNA CTD PMID:28973697 Usp47 Rat aflatoxin B1 decreases methylation ISO USP47 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of USP47 gene CTD PMID:27153756 Usp47 Rat aflatoxin B1 increases methylation ISO USP47 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of USP47 gene CTD PMID:28458013 Usp47 Rat antirheumatic drug increases expression ISO USP47 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of USP47 mRNA CTD PMID:24449571 Usp47 Rat arsane affects methylation ISO USP47 (Homo sapiens) 6480464 Arsenic affects the methylation of USP47 gene CTD PMID:25304211 Usp47 Rat arsenic atom affects methylation ISO USP47 (Homo sapiens) 6480464 Arsenic affects the methylation of USP47 gene CTD PMID:25304211 Usp47 Rat arsenite(3-) increases expression ISO Usp47 (Mus musculus) 6480464 arsenite results in increased expression of USP47 protein CTD PMID:37955338 Usp47 Rat arsenite(3-) multiple interactions ISO USP47 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to USP47 mRNA] CTD PMID:32406909 Usp47 Rat benzo[a]pyrene decreases expression ISO USP47 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of USP47 mRNA CTD PMID:20064835 and PMID:26238291 Usp47 Rat benzo[a]pyrene affects methylation ISO USP47 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of USP47 intron and Benzo(a)pyrene affects the methylation of USP47 promoter CTD PMID:27901495 and PMID:30157460 Usp47 Rat benzo[a]pyrene diol epoxide I decreases expression ISO USP47 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 and PMID:26238291 Usp47 Rat beta-lapachone increases expression ISO USP47 (Homo sapiens) 6480464 beta-lapachone results in increased expression of USP47 mRNA CTD PMID:38218311 Usp47 Rat bisphenol A increases expression ISO Usp47 (Mus musculus) 6480464 bisphenol A results in increased expression of USP47 mRNA CTD PMID:26063408 Usp47 Rat bisphenol A decreases expression ISO USP47 (Homo sapiens) 6480464 bisphenol A results in decreased expression of USP47 protein CTD PMID:31675489 Usp47 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of USP47 mRNA CTD PMID:25181051 more ... Usp47 Rat Bisphenol A diglycidyl ether affects splicing ISO Usp47 (Mus musculus) 6480464 bisphenol A diglycidyl ether affects the splicing of USP47 mRNA CTD PMID:36464114 Usp47 Rat bisphenol AF affects splicing ISO Usp47 (Mus musculus) 6480464 bisphenol AF affects the splicing of USP47 mRNA CTD PMID:36464114 Usp47 Rat bisphenol AF increases expression ISO USP47 (Homo sapiens) 6480464 bisphenol AF results in increased expression of USP47 protein CTD PMID:34186270 Usp47 Rat butanal decreases expression ISO USP47 (Homo sapiens) 6480464 butyraldehyde results in decreased expression of USP47 mRNA CTD PMID:26079696 Usp47 Rat cadmium atom decreases expression ISO Usp47 (Mus musculus) 6480464 Cadmium results in decreased expression of USP47 mRNA CTD PMID:24067728 Usp47 Rat cadmium dichloride decreases expression ISO USP47 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of USP47 mRNA CTD PMID:38568856 Usp47 Rat caffeine increases phosphorylation ISO USP47 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of USP47 protein CTD PMID:35688186 Usp47 Rat chlordecone increases expression ISO Usp47 (Mus musculus) 6480464 Chlordecone results in increased expression of USP47 mRNA CTD PMID:33711761 Usp47 Rat chlorpyrifos decreases expression ISO Usp47 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of USP47 mRNA CTD PMID:37019170 Usp47 Rat cisplatin multiple interactions ISO USP47 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of USP47 mRNA CTD PMID:27392435 Usp47 Rat cobalt dichloride increases expression ISO USP47 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of USP47 mRNA CTD PMID:19376846 Usp47 Rat copper(II) sulfate increases expression ISO USP47 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of USP47 mRNA CTD PMID:19549813 Usp47 Rat coumarin increases phosphorylation ISO USP47 (Homo sapiens) 6480464 coumarin results in increased phosphorylation of USP47 protein CTD PMID:35688186 Usp47 Rat crocidolite asbestos decreases expression ISO Usp47 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of USP47 mRNA CTD PMID:29279043 Usp47 Rat cyclosporin A increases expression ISO USP47 (Homo sapiens) 6480464 Cyclosporine results in increased expression of USP47 mRNA CTD PMID:20106945 and PMID:25562108 Usp47 Rat decabromodiphenyl ether increases expression ISO USP47 (Homo sapiens) 6480464 decabromobiphenyl ether results in increased expression of USP47 protein CTD PMID:31675489 Usp47 Rat dibutyl phthalate increases expression ISO Usp47 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of USP47 mRNA CTD PMID:21266533 Usp47 Rat dicrotophos decreases expression ISO USP47 (Homo sapiens) 6480464 dicrotophos results in decreased expression of USP47 mRNA CTD PMID:28302478 Usp47 Rat disodium selenite increases expression ISO USP47 (Homo sapiens) 6480464 Sodium Selenite results in increased expression of USP47 mRNA CTD PMID:18175754 Usp47 Rat dorsomorphin multiple interactions ISO USP47 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Usp47 Rat doxorubicin increases expression ISO Usp47 (Mus musculus) 6480464 Doxorubicin results in increased expression of USP47 mRNA CTD PMID:25896364 Usp47 Rat elemental selenium decreases expression ISO USP47 (Homo sapiens) 6480464 Selenium results in decreased expression of USP47 mRNA CTD PMID:19244175 Usp47 Rat elemental selenium multiple interactions ISO USP47 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in decreased expression of USP47 mRNA CTD PMID:19244175 Usp47 Rat endosulfan decreases expression ISO USP47 (Homo sapiens) 6480464 Endosulfan results in decreased expression of USP47 mRNA CTD PMID:30090376 Usp47 Rat entinostat decreases expression ISO USP47 (Homo sapiens) 6480464 entinostat results in decreased expression of USP47 mRNA CTD PMID:26272509 Usp47 Rat entinostat multiple interactions ISO USP47 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of USP47 mRNA CTD PMID:27188386 Usp47 Rat fenthion decreases expression ISO Usp47 (Mus musculus) 6480464 Fenthion results in decreased expression of USP47 mRNA CTD PMID:34813904 Usp47 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of USP47 mRNA CTD PMID:24136188 Usp47 Rat FR900359 affects phosphorylation ISO USP47 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of USP47 protein CTD PMID:37730182 Usp47 Rat genistein decreases expression ISO Usp47 (Mus musculus) 6480464 Genistein results in decreased expression of USP47 mRNA CTD PMID:32186404 Usp47 Rat ivermectin decreases expression ISO USP47 (Homo sapiens) 6480464 Ivermectin results in decreased expression of USP47 protein CTD PMID:32959892 Usp47 Rat methylmercury chloride decreases expression ISO USP47 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of USP47 mRNA CTD PMID:28001369 Usp47 Rat nefazodone increases expression EXP 6480464 nefazodone results in increased expression of USP47 mRNA CTD PMID:24136188 Usp47 Rat nickel atom decreases expression ISO USP47 (Homo sapiens) 6480464 Nickel results in decreased expression of USP47 mRNA CTD PMID:24768652 and PMID:25583101 Usp47 Rat pentachlorophenol increases expression ISO Usp47 (Mus musculus) 6480464 Pentachlorophenol results in increased expression of USP47 mRNA CTD PMID:23892564 Usp47 Rat perfluorooctane-1-sulfonic acid decreases expression ISO USP47 (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in decreased expression of USP47 mRNA CTD PMID:27153767 Usp47 Rat phenylmercury acetate decreases expression ISO USP47 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of USP47 mRNA CTD PMID:26272509 Usp47 Rat phenylmercury acetate multiple interactions ISO USP47 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of USP47 mRNA CTD PMID:27188386 Usp47 Rat resveratrol multiple interactions ISO Usp47 (Mus musculus) 6480464 Resveratrol inhibits the reaction [titanium dioxide results in decreased expression of USP47 mRNA] CTD PMID:31298478 Usp47 Rat resveratrol multiple interactions ISO USP47 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of USP47 mRNA CTD PMID:23557933 Usp47 Rat SB 431542 multiple interactions ISO USP47 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 and PMID:37664457 Usp47 Rat selenium atom multiple interactions ISO USP47 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in decreased expression of USP47 mRNA CTD PMID:19244175 Usp47 Rat selenium atom decreases expression ISO USP47 (Homo sapiens) 6480464 Selenium results in decreased expression of USP47 mRNA CTD PMID:19244175 Usp47 Rat sodium arsenate increases expression ISO Usp47 (Mus musculus) 6480464 sodium arsenate results in increased expression of USP47 mRNA CTD PMID:21795629 Usp47 Rat sodium arsenite increases expression ISO USP47 (Homo sapiens) 6480464 sodium arsenite results in increased expression of USP47 mRNA CTD PMID:38568856 Usp47 Rat succimer multiple interactions ISO USP47 (Homo sapiens) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in increased expression of USP47 mRNA CTD PMID:26378955 Usp47 Rat testosterone enanthate affects expression ISO USP47 (Homo sapiens) 6480464 testosterone enanthate affects the expression of USP47 mRNA CTD PMID:17440010 Usp47 Rat tetrachloromethane increases methylation EXP 6480464 Carbon Tetrachloride results in increased methylation of USP47 promoter CTD PMID:30690589 Usp47 Rat tetrachloromethane increases expression ISO Usp47 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of USP47 mRNA CTD PMID:31919559 Usp47 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of USP47 mRNA CTD PMID:30690589 Usp47 Rat titanium dioxide multiple interactions ISO Usp47 (Mus musculus) 6480464 Resveratrol inhibits the reaction [titanium dioxide results in decreased expression of USP47 mRNA] CTD PMID:31298478 Usp47 Rat titanium dioxide decreases expression ISO Usp47 (Mus musculus) 6480464 titanium dioxide results in decreased expression of USP47 mRNA CTD PMID:31298478 Usp47 Rat tremolite asbestos decreases expression ISO Usp47 (Mus musculus) 6480464 tremolite results in decreased expression of USP47 mRNA CTD PMID:29279043 Usp47 Rat trichostatin A decreases expression ISO USP47 (Homo sapiens) 6480464 trichostatin A results in decreased expression of USP47 mRNA CTD PMID:24935251 Usp47 Rat triphenyl phosphate affects expression ISO USP47 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of USP47 mRNA CTD PMID:37042841 Usp47 Rat Triptolide increases expression ISO Usp47 (Mus musculus) 6480464 triptolide results in increased expression of USP47 mRNA CTD PMID:32835833 Usp47 Rat valproic acid affects expression ISO USP47 (Homo sapiens) 6480464 Valproic Acid affects the expression of USP47 mRNA CTD PMID:25979313 Usp47 Rat valproic acid decreases expression ISO USP47 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of USP47 mRNA CTD PMID:23179753 more ... Usp47 Rat valproic acid multiple interactions ISO USP47 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of USP47 mRNA CTD PMID:27188386 Usp47 Rat vitamin E multiple interactions ISO USP47 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in decreased expression of USP47 mRNA CTD PMID:19244175 Usp47 Rat vitamin E decreases expression ISO USP47 (Homo sapiens) 6480464 Vitamin E results in decreased expression of USP47 mRNA CTD PMID:19244175
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 1,3-dinitrobenzene (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 3,3',5,5'-tetrabromobisphenol A (ISO) 4,4'-diaminodiphenylmethane (EXP,ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) aflatoxin B1 (ISO) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) Bisphenol A diglycidyl ether (ISO) bisphenol AF (ISO) butanal (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) chlordecone (ISO) chlorpyrifos (ISO) cisplatin (ISO) cobalt dichloride (ISO) copper(II) sulfate (ISO) coumarin (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) decabromodiphenyl ether (ISO) dibutyl phthalate (ISO) dicrotophos (ISO) disodium selenite (ISO) dorsomorphin (ISO) doxorubicin (ISO) elemental selenium (ISO) endosulfan (ISO) entinostat (ISO) fenthion (ISO) flutamide (EXP) FR900359 (ISO) genistein (ISO) ivermectin (ISO) methylmercury chloride (ISO) nefazodone (EXP) nickel atom (ISO) pentachlorophenol (ISO) perfluorooctane-1-sulfonic acid (ISO) phenylmercury acetate (ISO) resveratrol (ISO) SB 431542 (ISO) selenium atom (ISO) sodium arsenate (ISO) sodium arsenite (ISO) succimer (ISO) testosterone enanthate (ISO) tetrachloromethane (EXP,ISO) titanium dioxide (ISO) tremolite asbestos (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) Triptolide (ISO) valproic acid (ISO) vitamin E (ISO)
Usp47 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 175,586,758 - 175,669,904 (+) NCBI GRCr8 mRatBN7.2 1 166,152,104 - 166,235,312 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 166,152,199 - 166,235,312 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 174,487,162 - 174,570,366 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 181,673,157 - 181,756,359 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 174,373,161 - 174,456,333 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 176,854,589 - 176,937,763 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 176,854,653 - 176,937,763 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 169,836,253 - 169,920,055 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 169,947,098 - 170,039,002 (+) NCBI Celera 1 164,029,805 - 164,112,586 (+) NCBI Celera Cytogenetic Map 1 q33 NCBI
USP47 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 11,841,972 - 11,961,887 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 11,841,423 - 11,961,887 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 11,863,519 - 11,983,434 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 11,819,546 - 11,937,448 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 11,820,140 - 11,934,691 NCBI Celera 11 11,987,161 - 12,106,131 (+) NCBI Celera Cytogenetic Map 11 p15.3 NCBI HuRef 11 11,538,966 - 11,656,900 (+) NCBI HuRef CHM1_1 11 11,862,028 - 11,979,798 (+) NCBI CHM1_1 T2T-CHM13v2.0 11 11,931,131 - 12,053,770 (+) NCBI T2T-CHM13v2.0
Usp47 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 111,622,692 - 111,710,591 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 111,622,711 - 111,710,868 (+) Ensembl GRCm39 Ensembl GRCm38 7 112,023,476 - 112,111,386 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 112,023,504 - 112,111,661 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 119,167,020 - 119,254,894 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 111,814,687 - 111,902,561 (+) NCBI MGSCv36 mm8 Celera 7 111,998,866 - 112,086,718 (+) NCBI Celera Cytogenetic Map 7 F1 NCBI cM Map 7 58.74 NCBI
Usp47 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955414 27,357,602 - 27,462,731 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955414 27,357,602 - 27,462,481 (+) NCBI ChiLan1.0 ChiLan1.0
USP47 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 14,288,095 - 14,405,971 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 14,250,741 - 14,368,585 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 12,009,770 - 12,127,425 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 11,703,617 - 11,821,074 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 11,703,617 - 11,821,074 (+) Ensembl panpan1.1 panPan2
USP47 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 21 34,917,664 - 35,027,969 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 21 34,911,269 - 35,026,790 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 21 34,474,475 - 34,592,291 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 21 35,785,967 - 35,904,085 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 21 35,785,915 - 35,903,530 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 21 35,047,648 - 35,165,601 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 21 35,225,495 - 35,343,446 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 21 35,512,018 - 35,629,856 (+) NCBI UU_Cfam_GSD_1.0
Usp47 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404947 50,450,282 - 50,561,650 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936528 6,481,507 - 6,595,771 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936528 6,483,898 - 6,596,136 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
USP47 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 47,449,161 - 47,582,819 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 47,449,162 - 47,583,893 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 50,764,919 - 50,825,320 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
USP47 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 52,872,514 - 52,989,111 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 52,875,465 - 52,988,505 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 150,473,946 - 150,593,952 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Usp47
.
Predicted Target Of
Count of predictions: 495 Count of miRNA genes: 260 Interacting mature miRNAs: 324 Transcripts: ENSRNOT00000065712 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61442 Strs1 Sensitivity to stroke QTL 1 7.4 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 1 121767634 166767634 Rat 1578778 Pur4 Proteinuria QTL 4 3.3 0.003 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 1 150700247 252085048 Rat 1354646 Kidm18 Kidney mass QTL 18 5.7 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 256448636 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 2302378 Insul11 Insulin level QTL 11 3.25 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 144267353 251128347 Rat 1578770 Stresp23 Stress response QTL 23 kidney sympathetic nerve activity (VT:0004050) stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786) 1 123350408 182418476 Rat 70160 Bw18 Body weight QTL 18 5.7 body mass (VT:0001259) body weight (CMO:0000012) 1 144267353 196383668 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 631199 Cm23 Cardiac mass QTL 23 4.6 0.0004 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 115585465 172949803 Rat 1354636 Lmblg1 Limb length QTL 1 6.4 tibia length (VT:0004357) tibia length (CMO:0000450) 1 151162512 201278233 Rat 1549837 Hcar15 Hepatocarcinoma resistance QTL 15 0.05 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 153136852 260522016 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 1598853 Memor3 Memory QTL 3 4.5 exploratory behavior trait (VT:0010471) total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) 1 143506580 212458660 Rat 1354634 Kidm12 Kidney mass QTL 12 3.9 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 1 151162512 201278233 Rat 4889428 Stresp24 Stress response QTL 24 0.05 heart pumping trait (VT:2000009) absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162) 1 155866514 200866514 Rat 152025232 Bw192 Body weight QTL 192 3.93 body mass (VT:0001259) 1 117917486 196963478 Rat 1578759 Uae30 Urinary albumin excretion QTL 30 3.3 0.003 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 150700247 252085048 Rat 61343 Bp28 Blood pressure QTL 28 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 151646613 196646613 Rat 724521 Uae1 Urinary albumin excretion QTL 1 3.8 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 90508614 173018436 Rat 1358902 Bw47 Body weight QTL 47 1.67 body mass (VT:0001259) body weight (CMO:0000012) 1 90508614 180359386 Rat 61347 Bp197 Blood pressure QTL 197 4.2 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 1 158633083 203633083 Rat 61348 Bp30 Blood pressure QTL 30 2.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 144017057 197814409 Rat 8655649 Arrd1 Age-related retinal degeneration QTL 1 4.89 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 100357752 183970443 Rat 2303622 Vencon6 Ventilatory control QTL 6 0.001 respiration trait (VT:0001943) respiration rate (CMO:0000289) 1 154561505 199561505 Rat 7771612 Cm80 Cardiac mass QTL 80 8.4 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 1 149448574 221264292 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 631205 Bp196 Blood pressure QTL 196 4 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118944897 199050459 Rat 1300158 Bp173 Blood pressure QTL 173 3.48 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 1 115540693 185145286 Rat 737828 Hcas3 Hepatocarcinoma susceptibility QTL 3 4.9 liver integrity trait (VT:0010547) liver tumorous lesion volume to total liver volume ratio (CMO:0001082) 1 144267353 222987745 Rat 1331749 Hrtrt11 Heart rate QTL 11 2.973 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 94494440 198211706 Rat 1354661 Bw33 Body weight QTL 33 5.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 1358886 Bp260 Blood pressure QTL 260 3.67 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 151162766 225824951 Rat 1331751 Bp199 Blood pressure QTL 199 3.60022 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 94494440 181830018 Rat 9685799 Bp375 Blood pressure QTL 375 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 2293140 Bp313 Blood pressure QTL 313 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121833674 166833674 Rat 724531 Uae5 Urinary albumin excretion QTL 5 4 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 1 150700142 252085212 Rat 9685802 Bp376 Blood pressure QTL 376 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 126540680 171540680 Rat 737974 Bp161 Blood pressure QTL 161 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 164747558 181133855 Rat 1641895 Bp298 Blood pressure QTL 298 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 123350408 182418476 Rat 70209 Niddm23 Non-insulin dependent diabetes mellitus QTL 23 2.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 94494440 198324465 Rat 1354580 Scort1 Serum corticosterone level QTL 1 3.4 blood corticosterone amount (VT:0005345) blood corticosterone level (CMO:0001172) 1 156677124 256448636 Rat 634315 Niddm45 Non-insulin dependent diabetes mellitus QTL 45 7.16 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 1 144267916 172949660 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 61379 Bp44 Blood pressure QTL 44 19.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 144267916 174133260 Rat 1331793 Bp200 Blood pressure QTL 200 3.71601 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94494440 172949803 Rat 2312420 Pur17 Proteinuria QTL 17 7.1 0.0001 urine protein amount (VT:0005160) urine total protein excretion rate (CMO:0000756) 1 156677124 218753816 Rat 6893347 Bw98 Body weight QTL 98 0.2 0.53 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354591 Cm36 Cardiac mass QTL 36 4.1 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 102813953 201278233 Rat 724550 Thym3 Thymus enlargement QTL 3 7.82 0.001 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 136829932 181829932 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 71118 Thym1 Thymus enlargement QTL 1 10.17 0.001 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 136829932 181829932 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 619613 Bp77 Blood pressure QTL 77 0.01 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 164747424 209747424 Rat 631519 Pia11 Pristane induced arthritis QTL 11 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 136830018 181830018 Rat 6893361 Bw104 Body weight QTL 104 0.59 0.27 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 2292222 Bp307 Blood pressure QTL 307 3.06 0.0014 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 213533942 Rat 738006 Anxrr14 Anxiety related response QTL 14 4 0.00035 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 2292220 Bp306 Blood pressure QTL 306 3.47 0.00087 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 243914901 Rat 1558645 Bw55 Body weight QTL 55 3.2 0.004 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354615 Cm32 Cardiac mass QTL 32 5.2 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 102813953 201278233 Rat 1582204 Livw1 Liver weight QTL 1 3.6 0.0003 liver mass (VT:0003402) liver weight to body weight ratio (CMO:0000633) 1 155422851 172949803 Rat 634348 Bp138 Blood pressure QTL 138 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 168883176 Rat 1354610 Bw34 Body weight QTL 34 4.1 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 738028 Anxrr12 Anxiety related response QTL 12 4.9 0.00001 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1354620 Kidm19 Kidney mass QTL 19 4 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 201278233 Rat 8693608 Alc24 Alcohol consumption QTL 24 2.3 0.74 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 1 150452391 168228760 Rat 1354618 Kidm15 Kidney mass QTL 15 5 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 1 156677124 201278233 Rat 631654 Bp107 Blood pressure QTL 107 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 631544 Bp84 Blood pressure QTL 84 5.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350408 181759564 Rat 152025212 Bw190 Body weight QTL 190 5.7 body mass (VT:0001259) 1 123556856 196963478 Rat 631549 Bp89 Blood pressure QTL 89 5.7 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350581 201284552 Rat 631548 Bp88 Blood pressure QTL 88 5 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 156677124 176484451 Rat 1358189 Cstrr1 Cold stress response QTL 1 0.0001 catecholamine amount (VT:0010543) urine norepinephrine level (CMO:0001629) 1 123350408 182418476 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat 1354602 Bw35 Body weight QTL 35 12.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 201278233 Rat
RH129481
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 166,234,227 - 166,234,407 (+) MAPPER mRatBN7.2 Rnor_6.0 1 176,936,679 - 176,936,858 NCBI Rnor6.0 Rnor_5.0 1 183,916,072 - 183,916,251 UniSTS Rnor5.0 RGSC_v3.4 1 169,918,971 - 169,919,150 UniSTS RGSC3.4 Celera 1 164,111,502 - 164,111,681 UniSTS RH 3.4 Map 1 1324.3 UniSTS Cytogenetic Map 1 q33 UniSTS
RH135216
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 166,226,038 - 166,226,248 (+) MAPPER mRatBN7.2 Rnor_6.0 1 176,928,491 - 176,928,700 NCBI Rnor6.0 Rnor_5.0 1 183,907,884 - 183,908,093 UniSTS Rnor5.0 RGSC_v3.4 1 169,910,782 - 169,910,991 UniSTS RGSC3.4 Celera 1 164,103,335 - 164,103,544 UniSTS RH 3.4 Map 1 1318.6 UniSTS Cytogenetic Map 1 q33 UniSTS
RH139146
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 166,158,149 - 166,158,335 (+) MAPPER mRatBN7.2 Rnor_6.0 1 176,860,604 - 176,860,789 NCBI Rnor6.0 Rnor_5.0 1 183,839,997 - 183,840,182 UniSTS Rnor5.0 RGSC_v3.4 1 169,842,894 - 169,843,079 UniSTS RGSC3.4 Celera 1 164,035,756 - 164,035,941 UniSTS RH 3.4 Map 1 1317.9 UniSTS Cytogenetic Map 1 q33 UniSTS
RH139740
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 166,234,867 - 166,235,082 (+) MAPPER mRatBN7.2 Rnor_6.0 1 176,937,319 - 176,937,533 NCBI Rnor6.0 Rnor_5.0 1 183,916,712 - 183,916,926 UniSTS Rnor5.0 RGSC_v3.4 1 169,919,611 - 169,919,825 UniSTS RGSC3.4 Celera 1 164,112,142 - 164,112,356 UniSTS RH 3.4 Map 1 1324.3 UniSTS Cytogenetic Map 1 q33 UniSTS
USP47__5050
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 166,233,903 - 166,234,412 (+) MAPPER mRatBN7.2 Rnor_6.0 1 176,936,355 - 176,936,863 NCBI Rnor6.0 Rnor_5.0 1 183,915,748 - 183,916,256 UniSTS Rnor5.0 RGSC_v3.4 1 169,918,647 - 169,919,155 UniSTS RGSC3.4 Celera 1 164,111,178 - 164,111,686 UniSTS Cytogenetic Map 1 q33 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000065712 ⟹ ENSRNOP00000058846
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 166,152,199 - 166,235,312 (+) Ensembl Rnor_6.0 Ensembl 1 176,854,653 - 176,937,763 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000087461 ⟹ ENSRNOP00000069266
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 166,152,382 - 166,235,311 (+) Ensembl Rnor_6.0 Ensembl 1 176,854,816 - 176,936,884 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000097971 ⟹ ENSRNOP00000088486
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 166,176,133 - 166,235,312 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000116456 ⟹ ENSRNOP00000088488
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 166,182,998 - 166,235,312 (+) Ensembl
RefSeq Acc Id:
NM_001107542 ⟹ NP_001101012
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,586,792 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,199 - 166,235,312 (+) NCBI Rnor_6.0 1 176,854,653 - 176,937,763 (+) NCBI Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI RGSC_v3.4 1 169,836,253 - 169,920,055 (+) RGD Celera 1 164,029,805 - 164,112,586 (+) RGD
Sequence:
CGGGGCAGAGCAAGAGGTGAGAAGATCCCGAGCTCGCCACGGCAGCACACGTTCCTCAGGCCAGGCGCCGGGCCGCGCGCCCACTGAGCTGAATTCTCGCGAGAGCGGCAGCCGCCATTTTTCCATTG
hide sequence
RefSeq Acc Id:
XM_006230044 ⟹ XP_006230106
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,587,053 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,467 - 166,235,312 (+) NCBI Rnor_6.0 1 176,854,827 - 176,937,763 (+) NCBI Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI
Sequence:
GCGGCGGCGCCCTGGGTCGGTGTCTGCGCGCTGGTGTCTAAGGCCTGAGCGGAGGCCTCCGCAG
hide sequence
RefSeq Acc Id:
XM_006230045 ⟹ XP_006230107
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,587,053 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,341 - 166,235,312 (+) NCBI Rnor_6.0 1 176,854,589 - 176,937,763 (+) NCBI Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI
Sequence:
GACAGGATTCCCGGTAGTGAAAGGTGCTTACACCGTTCCTCGACCAGCATAGCGTTGCGTATTC
hide sequence
RefSeq Acc Id:
XM_006230046 ⟹ XP_006230108
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,587,053 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,467 - 166,235,312 (+) NCBI Rnor_6.0 1 176,854,827 - 176,937,763 (+) NCBI Rnor_5.0 1 183,833,960 - 183,917,156 (+) NCBI
Sequence:
GCGGCGGCGCCCTGGGTCGGTGTCTGCGCGCTGGTGTCTAAGGCCTGAGCGGAGGCCTCCGCAGTTGCTGGAGCGCAGGCGGCTGGGAGGATGACTACCACTGCCATTCTTTCCTGAGACGCAGAGCC
hide sequence
RefSeq Acc Id:
XM_039078090 ⟹ XP_038934018
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,587,054 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,466 - 166,235,312 (+) NCBI
RefSeq Acc Id:
XM_039078096 ⟹ XP_038934024
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 175,586,758 - 175,669,904 (+) NCBI mRatBN7.2 1 166,152,104 - 166,235,312 (+) NCBI
RefSeq Acc Id:
NP_001101012 ⟸ NM_001107542
- UniProtKB:
F1MAA1 (UniProtKB/TrEMBL), A0A8I6AAW7 (UniProtKB/TrEMBL)
- Sequence:
MVPGEENQLVPKEIENAAEEPRVLCIIQDTTNSKTVNERITVNLPASTPVRKLFEDVANKVGYINGTFDLTWGNGINTADLAPLDHTSDKSLLDANFEPGKKNFLHLTDKDGEQPQMLLDDSSHVDDS
hide sequence
RefSeq Acc Id:
XP_006230107 ⟸ XM_006230045
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I6AAW7 (UniProtKB/TrEMBL)
- Sequence:
MVPGEENQLVPKEIENAAEEPRVLCIIQDTTNSKTVNERITVNLPASTPVRKLFEDVANKVGYINGTFDLTWGNGINTADLAPLDHTSDKSLLDANFEPGKKNFLHLTDKDGEQPQMLLDDSSHVDDS
hide sequence
RefSeq Acc Id:
XP_006230106 ⟸ XM_006230044
- Peptide Label:
isoform X1
- UniProtKB:
A0A0G2JUX4 (UniProtKB/TrEMBL), A0A8I6A571 (UniProtKB/TrEMBL)
- Sequence:
MVPGEENQLVPKEDVFWRCRQNIFDEMKKKFLQIENAAEEPRVLCIIQDTTNSKTVNERITVNLPASTPVRKLFEDVANKVGYINGTFDLTWGNGINTADLAPLDHTSDKSLLDANFEPGKKNFLHLT
hide sequence
RefSeq Acc Id:
XP_006230108 ⟸ XM_006230046
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I6A571 (UniProtKB/TrEMBL)
- Sequence:
MVPGEENQLVPKEDVFWRCRQNIFDEMKKKFLQIENAAEEPRVLCIIQDTTNSKTVNERITVNLPASTPVRKLFEDVANKVGYINGTFDLTWGNGINTADLAPLDHTSDKSLLDANFEPGKKNFLHLT
hide sequence
Ensembl Acc Id:
ENSRNOP00000069266 ⟸ ENSRNOT00000087461
Ensembl Acc Id:
ENSRNOP00000058846 ⟸ ENSRNOT00000065712
RefSeq Acc Id:
XP_038934024 ⟸ XM_039078096
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6AAW7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038934018 ⟸ XM_039078090
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6AAW7 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000088486 ⟸ ENSRNOT00000097971
Ensembl Acc Id:
ENSRNOP00000088488 ⟸ ENSRNOT00000116456
RGD ID: 13690325 Promoter ID: EPDNEW_R844 Type: initiation region Name: Usp47_1 Description: ubiquitin specific peptidase 47 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 176,854,848 - 176,854,908 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-04
Usp47
ubiquitin specific peptidase 47
Usp47_predicted
ubiquitin specific protease 47 (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-12
Usp47_predicted
ubiquitin specific protease 47 (predicted)
Symbol and Name status set to approved
70820 APPROVED
