Symbol:
Map3k7
Name:
mitogen activated protein kinase kinase kinase 7
RGD ID:
1309438
Description:
Enables several functions, including ATP binding activity; enzyme binding activity; and protein kinase activity. Involved in several processes, including positive regulation of cell size; positive regulation of intracellular signal transduction; and positive regulation of vascular associated smooth muscle cell migration. Predicted to be located in plasma membrane and postsynaptic density. Predicted to be part of ATAC complex. Predicted to be active in cytosol and endoplasmic reticulum membrane. Used to study arteriosclerosis. Biomarker of chronic kidney disease and myocardial infarction. Human ortholog(s) of this gene implicated in frontometaphyseal dysplasia; frontometaphyseal dysplasia 2; and prostate cancer. Orthologous to human MAP3K7 (mitogen-activated protein kinase kinase kinase 7); PARTICIPATES IN p38 MAPK signaling pathway; Bone morphogenetic proteins signaling pathway; c-Jun N-terminal kinases MAPK signaling pathway; INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC100910771; mitogen-activated protein kinase kinase kinase 7; mitogen-activated protein kinase kinase kinase 7-like; Tak1; TGF-beta activated kinase 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 51,149,524 - 51,212,012 (+) NCBI GRCr8 mRatBN7.2 5 46,356,973 - 46,415,597 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 46,357,931 - 46,415,597 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 48,494,947 - 48,552,846 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 50,094,119 - 50,152,018 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 50,043,393 - 50,101,289 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 47,183,142 - 47,244,424 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 47,186,558 - 47,244,416 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 114,022,137 - 114,079,089 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 51,793,737 - 51,852,677 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 48,252,637 - 48,308,820 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 48,252,815 - 48,309,011 (+) NCBI Celera 5 45,121,067 - 45,178,378 (+) NCBI Celera Cytogenetic Map 5 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Map3k7 Rat (+)-Erythraline decreases activity ISO Map3k7 (Mus musculus) 6480464 erythraline results in decreased activity of MAP3K7 protein CTD PMID:23902980 Map3k7 Rat (-)-demecolcine decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Demecolcine results in decreased expression of MAP3K7 mRNA CTD PMID:23649840 Map3k7 Rat (1->4)-beta-D-glucan multiple interactions ISO Map3k7 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of MAP3K7 mRNA CTD PMID:36331819 Map3k7 Rat 1,2-dimethylhydrazine increases expression ISO Map3k7 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of MAP3K7 mRNA CTD PMID:22206623 Map3k7 Rat 17beta-estradiol multiple interactions EXP 6480464 1 more ... CTD PMID:29625166 Map3k7 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Map3k7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MAP3K7 mRNA CTD PMID:19770486 Map3k7 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of MAP3K7 mRNA CTD PMID:33387578 Map3k7 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Map3k7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MAP3K7 mRNA CTD PMID:21570461 Map3k7 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of MAP3K7 mRNA CTD PMID:21346803 Map3k7 Rat 2-Hydroxy-6-(8,11,14-pentadecatrienyl)benzoic acid decreases activity ISO MAP3K7 (Homo sapiens) 6480464 anacardic acid results in decreased activity of MAP3K7 protein CTD PMID:18349320 Map3k7 Rat 2-hydroxypropanoic acid decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of MAP3K7 mRNA CTD PMID:30851411 Map3k7 Rat 5Z-7-oxozeaenol decreases phosphorylation ISO Map3k7 (Mus musculus) 11555743 5Z-7-oxozeaenol decreases phosphorylation of Map3k7 protein in hypertrophic heart RGD Map3k7 Rat actinomycin D decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Dactinomycin results in decreased expression of MAP3K7 mRNA CTD PMID:16001973 Map3k7 Rat aflatoxin B1 decreases methylation ISO MAP3K7 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of MAP3K7 gene CTD PMID:27153756 Map3k7 Rat AICA ribonucleotide increases activity EXP 155791450 AICAR increases activity of Map3k7 protein in cardiac muscle cells RGD Map3k7 Rat albiflorin multiple interactions ISO MAP3K7 (Homo sapiens) 155804296 Albiflorin inhibits the reaction [oxidized LDL increases phosphorylation of MAP3K7 protein in umbilical vein endothelial cells] RGD Map3k7 Rat alpha-Chaconine multiple interactions ISO Map3k7 (Mus musculus) 6480464 alpha-chaconine inhibits the reaction [lipopolysaccharide and Escherichia coli O111 B4 results in increased phosphorylation of MAP3K7 protein] CTD PMID:25913072 Map3k7 Rat angiotensin II increases expression ISO MAP3K7 (Homo sapiens) 155791647 Angiotensin II increases expression of MAP3K7 mRNA in cardiomyocytes RGD Map3k7 Rat antirheumatic drug increases expression ISO MAP3K7 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of MAP3K7 mRNA CTD PMID:24449571 Map3k7 Rat antirheumatic drug decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of MAP3K7 mRNA CTD PMID:25339124 Map3k7 Rat arjunolic acid multiple interactions EXP 155804266 Arjunolic acid promotes the reaction [Map3k7 protein binds to Ppara protein in cardiac fibroblasts] RGD Map3k7 Rat benzo[a]pyrene increases expression ISO Map3k7 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of MAP3K7 mRNA CTD PMID:20127859 Map3k7 Rat benzo[a]pyrene increases methylation ISO MAP3K7 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of MAP3K7 promoter CTD PMID:27901495 Map3k7 Rat benzo[a]pyrene decreases expression ISO Map3k7 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of MAP3K7 mRNA CTD PMID:19770486 Map3k7 Rat bis(2-chloroethyl) sulfide increases expression ISO Map3k7 (Mus musculus) 6480464 Mustard Gas results in increased expression of MAP3K7 mRNA CTD PMID:18955075 Map3k7 Rat bis(2-ethylhexyl) phthalate multiple interactions EXP 6480464 [Diethylhexyl Phthalate co-treated with Genistein] results in increased expression of MAP3K7 mRNA CTD PMID:32533902 Map3k7 Rat bisphenol A decreases expression ISO MAP3K7 (Homo sapiens) 6480464 bisphenol A results in decreased expression of MAP3K7 mRNA CTD PMID:16029874 Map3k7 Rat bisphenol A increases expression ISO Map3k7 (Mus musculus) 6480464 bisphenol A results in increased expression of MAP3K7 mRNA CTD PMID:33221593 Map3k7 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with tributyltin] results in increased expression of MAP3K7 mRNA CTD PMID:31129395 Map3k7 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MAP3K7 mRNA CTD PMID:25181051 more ... Map3k7 Rat bisphenol A decreases expression ISO Map3k7 (Mus musculus) 6480464 bisphenol A results in decreased expression of MAP3K7 mRNA CTD PMID:26063408 Map3k7 Rat cadmium atom increases phosphorylation EXP 6480464 Cadmium results in increased phosphorylation of MAP3K7 protein CTD PMID:32693121 Map3k7 Rat cadmium atom multiple interactions EXP 6480464 MAP3K7 protein affects the reaction [Cadmium results in decreased expression of SQSTM1 protein] more ... CTD PMID:32693121 Map3k7 Rat cadmium dichloride increases expression ISO Map3k7 (Mus musculus) 6480464 Cadmium Chloride results in increased expression of MAP3K7 mRNA CTD PMID:18974090 Map3k7 Rat cadmium dichloride decreases methylation EXP 6480464 Cadmium Chloride results in decreased methylation of MAP3K7 promoter CTD PMID:22457795 Map3k7 Rat camptothecin decreases response to substance ISO MAP3K7 (Homo sapiens) 6480464 MAP3K7 mRNA results in decreased susceptibility to Camptothecin CTD PMID:25269479 Map3k7 Rat cannabidiol decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Cannabidiol results in decreased expression of MAP3K7 mRNA CTD PMID:31801206 Map3k7 Rat capsaicin multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 7-oxozeanol inhibits the reaction [Capsaicin results in increased phosphorylation of and results in increased activity of MAP3K7 protein] more ... CTD PMID:22171160 Map3k7 Rat capsazepine multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 capsazepine inhibits the reaction [Capsaicin results in increased phosphorylation of and results in increased activity of MAP3K7 protein] CTD PMID:22171160 Map3k7 Rat carbamazepine affects expression ISO MAP3K7 (Homo sapiens) 6480464 Carbamazepine affects the expression of MAP3K7 mRNA CTD PMID:24752500 Map3k7 Rat carbon nanotube increases expression ISO Map3k7 (Mus musculus) 6480464 Nanotubes and Carbon results in increased expression of MAP3K7 mRNA CTD PMID:25620056 Map3k7 Rat casticin increases expression ISO MAP3K7 (Homo sapiens) 6480464 casticin results in increased expression of MAP3K7 mRNA CTD PMID:27862857 Map3k7 Rat CGP 52608 multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to MAP3K7 gene] CTD PMID:28238834 Map3k7 Rat cisplatin multiple interactions EXP 6480464 Pentoxifylline inhibits the reaction [Cisplatin results in increased expression of MAP3K7 protein] CTD PMID:32777238 Map3k7 Rat cisplatin increases expression EXP 6480464 Cisplatin results in increased expression of MAP3K7 protein CTD PMID:32777238 Map3k7 Rat corn oil increases expression ISO Map3k7 (Mus musculus) 6480464 Corn Oil results in increased expression of MAP3K7 mRNA CTD PMID:33263755 Map3k7 Rat corticosterone multiple interactions EXP 6480464 1 more ... CTD PMID:29625166 Map3k7 Rat corticosterone increases phosphorylation EXP 6480464 Corticosterone results in increased phosphorylation of MAP3K7 protein CTD PMID:29625166 Map3k7 Rat cortisol decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Hydrocortisone results in decreased expression of MAP3K7 mRNA CTD PMID:21267416 Map3k7 Rat coumarin affects phosphorylation ISO MAP3K7 (Homo sapiens) 6480464 coumarin affects the phosphorylation of MAP3K7 protein CTD PMID:35688186 Map3k7 Rat cyclosporin A increases phosphorylation ISO Map3k7 (Mus musculus) 6480464 Cyclosporine results in increased phosphorylation of MAP3K7 protein CTD PMID:23958496 Map3k7 Rat dextran sulfate multiple interactions ISO Map3k7 (Mus musculus) 6480464 flavokawain B inhibits the reaction [Dextran Sulfate results in increased phosphorylation of MAP3K7 protein] CTD PMID:38583725 Map3k7 Rat dextran sulfate increases phosphorylation ISO Map3k7 (Mus musculus) 6480464 Dextran Sulfate results in increased phosphorylation of MAP3K7 protein CTD PMID:38583725 Map3k7 Rat dibutyl phthalate increases expression ISO Map3k7 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of MAP3K7 mRNA CTD PMID:21266533 Map3k7 Rat diclofenac affects expression ISO MAP3K7 (Homo sapiens) 6480464 Diclofenac affects the expression of MAP3K7 mRNA CTD PMID:24752500 Map3k7 Rat dihydrolipoic acid decreases phosphorylation EXP 155804269 Dihydrolipoic acid decreases phosphorylation of Map3k7 protein in subarachnoid hemorrhage left cerebral hemisphere RGD Map3k7 Rat disodium selenite increases expression ISO MAP3K7 (Homo sapiens) 6480464 Sodium Selenite results in increased expression of MAP3K7 mRNA CTD PMID:18175754 Map3k7 Rat dorsomorphin multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MAP3K7 mRNA CTD PMID:27188386 Map3k7 Rat doxorubicin decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of MAP3K7 mRNA CTD PMID:29803840 Map3k7 Rat doxorubicin multiple interactions EXP 6480464 7-oxozeanol inhibits the reaction [Phosphocreatine inhibits the reaction [Doxorubicin results in decreased expression of MAP3K7 protein]] more ... CTD PMID:34358621 Map3k7 Rat doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of MAP3K7 protein CTD PMID:34358621 Map3k7 Rat elemental selenium decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Selenium results in decreased expression of MAP3K7 mRNA CTD PMID:19244175 Map3k7 Rat ethanol affects splicing ISO Map3k7 (Mus musculus) 6480464 Ethanol affects the splicing of MAP3K7 mRNA CTD PMID:30319688 Map3k7 Rat fasudil decreases expression ISO Map3k7 (Mus musculus) 6480464 fasudil results in decreased expression of MAP3K7 protein CTD PMID:22465603 Map3k7 Rat filipin III multiple interactions EXP 6480464 Filipin inhibits the reaction [ferrous sulfate promotes the reaction [MAP3K7 protein results in increased phosphorylation of MAP2K6 protein]] more ... CTD PMID:17172471 Map3k7 Rat flavokawain B multiple interactions ISO Map3k7 (Mus musculus) 6480464 flavokawain B inhibits the reaction [Dextran Sulfate results in increased phosphorylation of MAP3K7 protein] and flavokawain B inhibits the reaction [Pam(3)CSK(4) peptide results in increased phosphorylation of MAP3K7 protein] CTD PMID:38583725 Map3k7 Rat flutamide multiple interactions EXP 6480464 Flutamide inhibits the reaction [Estradiol inhibits the reaction [Corticosterone results in increased phosphorylation of MAP3K7 protein]] CTD PMID:29625166 Map3k7 Rat formaldehyde decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of MAP3K7 mRNA CTD PMID:23649840 Map3k7 Rat FR900359 affects phosphorylation ISO MAP3K7 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of MAP3K7 protein CTD PMID:37730182 Map3k7 Rat genistein multiple interactions EXP 6480464 [Diethylhexyl Phthalate co-treated with Genistein] results in increased expression of MAP3K7 mRNA CTD PMID:32533902 Map3k7 Rat hexadecanoic acid increases phosphorylation EXP 155804300 Palmitate increases phosphorylation of Map3k7 protein in neonatal ventricular cardiomyocytes RGD Map3k7 Rat hypochlorous acid increases expression ISO Map3k7 (Mus musculus) 6480464 Hypochlorous Acid results in increased expression of MAP3K7 mRNA CTD PMID:19376150 Map3k7 Rat iron atom multiple interactions EXP 6480464 Filipin inhibits the reaction [Iron promotes the reaction [MAP3K7 protein results in increased phosphorylation of MAP2K6 protein]] more ... CTD PMID:17172471 Map3k7 Rat iron atom increases activity EXP 6480464 Iron results in increased activity of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat iron atom affects localization EXP 6480464 Iron affects the localization of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat iron(0) multiple interactions EXP 6480464 Filipin inhibits the reaction [Iron promotes the reaction [MAP3K7 protein results in increased phosphorylation of MAP2K6 protein]] more ... CTD PMID:17172471 Map3k7 Rat iron(0) affects localization EXP 6480464 Iron affects the localization of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat iron(0) increases activity EXP 6480464 Iron results in increased activity of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat iron(2+) sulfate (anhydrous) increases activity EXP 6480464 ferrous sulfate results in increased activity of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat iron(2+) sulfate (anhydrous) multiple interactions EXP 6480464 ferrous sulfate promotes the reaction [MAP3K7 protein binds to HRAS protein binds to PIK3R1 protein] more ... CTD PMID:17172471 Map3k7 Rat iron(2+) sulfate (anhydrous) affects localization EXP 6480464 ferrous sulfate affects the localization of MAP3K7 protein CTD PMID:17172471 Map3k7 Rat kaempferol multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 kaempferol inhibits the reaction [IL1B protein results in increased phosphorylation of MAP3K7 protein] CTD PMID:30769083 Map3k7 Rat L-glutamic acid multiple interactions ISO Map3k7 (Mus musculus) 6480464 [TNF protein co-treated with Glutamic Acid] results in increased activity of MAP3K7 protein CTD PMID:36912451 Map3k7 Rat lipopolysaccharide multiple interactions ISO Map3k7 (Mus musculus) 6480464 Lipopolysaccharides results in increased phosphorylation of and results in increased activity of MAP3K7 protein and luteolin-7-O-glucuronide inhibits the reaction [Lipopolysaccharides results in increased phosphorylation of MAP3K7 protein] CTD PMID:23902980 and PMID:32187984 Map3k7 Rat lipopolysaccharide increases expression ISO Map3k7 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of MAP3K7 mRNA CTD PMID:12057914 Map3k7 Rat lipopolysaccharide increases phosphorylation ISO Map3k7 (Mus musculus) 6480464 Lipopolysaccharides results in increased phosphorylation of MAP3K7 protein CTD PMID:32187984 Map3k7 Rat maneb multiple interactions ISO Map3k7 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in increased expression of MAP3K7 mRNA CTD PMID:36117858 Map3k7 Rat manganese(II) chloride increases methylation ISO MAP3K7 (Homo sapiens) 6480464 manganese chloride results in increased methylation of MAP3K7 gene CTD PMID:27913844 Map3k7 Rat metformin multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [Paclitaxel co-treated with Metformin] results in decreased expression of MAP3K7 mRNA CTD PMID:29309887 Map3k7 Rat metformin increases activity EXP 155791450 Metformin increases activity of Map3k7 protein in cardiac muscle cells RGD Map3k7 Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of MAP3K7 mRNA CTD PMID:19564919 Map3k7 Rat methotrexate increases phosphorylation ISO MAP3K7 (Homo sapiens) 6480464 Methotrexate results in increased phosphorylation of MAP3K7 protein CTD PMID:19100307 Map3k7 Rat methotrexate decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Methotrexate results in decreased expression of MAP3K7 mRNA CTD PMID:25339124 Map3k7 Rat methylparaben increases expression ISO MAP3K7 (Homo sapiens) 6480464 methylparaben results in increased expression of MAP3K7 mRNA CTD PMID:31745603 Map3k7 Rat monocrotaline increases phosphorylation EXP 155791648 Monocrotaline increases phosphorylation of Map3k7 protein in the lung RGD Map3k7 Rat monocrotaline multiple interactions EXP 155804297 Paeoniflorin inhibits the reaction [monocrotaline increases phosphorylation of Map3k7 protein in the lung] RGD Map3k7 Rat monocrotaline increases phosphorylation EXP 155804297 Monocrotaline increases phosphorylation of Map3k7 protein in the lung RGD Map3k7 Rat myricetin decreases phosphorylation ISO Map3k7 (Mus musculus) 155791644 Myricetin decreases phosphorylation of Map3k7 protein in the heart RGD Map3k7 Rat N-phosphocreatine multiple interactions EXP 6480464 7-oxozeanol inhibits the reaction [Phosphocreatine inhibits the reaction [Doxorubicin results in decreased expression of MAP3K7 protein]] more ... CTD PMID:34358621 Map3k7 Rat nickel dichloride affects expression EXP 6480464 nickel chloride affects the expression of MAP3K7 mRNA CTD PMID:22546817 Map3k7 Rat nonanoic acid decreases expression ISO Map3k7 (Mus musculus) 6480464 pelargonic acid results in decreased expression of MAP3K7 mRNA CTD PMID:11379042 Map3k7 Rat o-anisidine decreases expression ISO MAP3K7 (Homo sapiens) 6480464 2-anisidine results in decreased expression of MAP3K7 mRNA CTD PMID:28089782 Map3k7 Rat oligomycin increases activity EXP 155791450 Oligomycin increases activity of Map3k7 protein in cardiac muscle cells RGD Map3k7 Rat olmesartan multiple interactions EXP 155791673 Olmesartan inhibits the reaction [Angiotensin II increases phosphorylation of Map3k7 protein in the heart] RGD Map3k7 Rat omega-3 fatty acid decreases phosphorylation EXP 155791672 Omega-3 fatty acid decreases phosphorylation of Map3k7 protein in cerebral cortex subarachnoid hemorrhage RGD Map3k7 Rat oxazepam increases expression ISO Map3k7 (Mus musculus) 6480464 Oxazepam results in increased expression of MAP3K7 mRNA CTD PMID:12727805 Map3k7 Rat oxidised LDL multiple interactions ISO MAP3K7 (Homo sapiens) 155804296 Albiflorin inhibits the reaction [oxidized LDL increases phosphorylation of MAP3K7 protein in umbilical vein endothelial cells] RGD Map3k7 Rat oxidised LDL increases phosphorylation ISO MAP3K7 (Homo sapiens) 155804296 Oxidized LDL increases phosphorylation of MAP3K7 protein in umbilical vein endothelial cells RGD Map3k7 Rat paclitaxel multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [Paclitaxel co-treated with Metformin] results in decreased expression of MAP3K7 mRNA CTD PMID:29309887 Map3k7 Rat paeoniflorin multiple interactions EXP 155804297 Paeoniflorin inhibits the reaction [monocrotaline increases phosphorylation of Map3k7 protein in the lung] RGD Map3k7 Rat paracetamol affects expression ISO Map3k7 (Mus musculus) 6480464 Acetaminophen affects the expression of MAP3K7 mRNA CTD PMID:17562736 Map3k7 Rat paraquat increases expression ISO Map3k7 (Mus musculus) 6480464 Paraquat results in increased expression of MAP3K7 mRNA CTD PMID:21371552 Map3k7 Rat paraquat multiple interactions ISO Map3k7 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in increased expression of MAP3K7 mRNA CTD PMID:36117858 Map3k7 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of MAP3K7 mRNA CTD PMID:32680482 Map3k7 Rat Pentoxifylline affects binding ISO MAP3K7 (Homo sapiens) 6480464 Pentoxifylline binds to MAP3K7 protein CTD PMID:32777238 Map3k7 Rat Pentoxifylline multiple interactions EXP 6480464 Pentoxifylline inhibits the reaction [Cisplatin results in increased expression of MAP3K7 protein] CTD PMID:32777238 Map3k7 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Map3k7 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of MAP3K7 mRNA CTD PMID:36331819 Map3k7 Rat phenylephrine increases phosphorylation EXP 155791643 phenylephrin increases phosphorylation of Map3k7 protein in neonatal cardiomyocytes RGD Map3k7 Rat phenylephrine multiple interactions EXP 155791674 Phenylephrine promotes the reaction [Map3k7 protein binds to Ripk2 protein] RGD Map3k7 Rat phenylephrine increases phosphorylation EXP 155791668 Phenylephrine increases phosphorylation of Map3k7 protein in neonatal cardiomyocytes RGD Map3k7 Rat phenylephrine multiple interactions EXP 155804287 Phenylephrine promotes the reaction [Map3k7 protein binds to Tab1 protein in neonatal cardiomyocytes] RGD Map3k7 Rat phenylmercury acetate decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of MAP3K7 mRNA CTD PMID:26272509 Map3k7 Rat phenylmercury acetate multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MAP3K7 mRNA CTD PMID:27188386 Map3k7 Rat phlorizin decreases expression ISO Map3k7 (Mus musculus) 6480464 Phlorhizin results in decreased expression of MAP3K7 mRNA CTD PMID:22538082 Map3k7 Rat pirinixic acid increases expression ISO Map3k7 (Mus musculus) 6480464 pirinixic acid results in increased expression of MAP3K7 mRNA CTD PMID:12727805 Map3k7 Rat pirinixic acid decreases expression ISO Map3k7 (Mus musculus) 6480464 pirinixic acid results in decreased expression of MAP3K7 mRNA CTD PMID:12727805 Map3k7 Rat quercetin multiple interactions ISO Map3k7 (Mus musculus) 6480464 7-oxozeanol inhibits the reaction [Quercetin results in increased phosphorylation of MAP3K7 protein] CTD PMID:22711909 Map3k7 Rat quercetin increases phosphorylation ISO Map3k7 (Mus musculus) 6480464 Quercetin results in increased phosphorylation of MAP3K7 protein CTD PMID:22711909 Map3k7 Rat rac-lactic acid decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of MAP3K7 mRNA CTD PMID:30851411 Map3k7 Rat reactive oxygen species multiple interactions ISO Map3k7 (Mus musculus) 6480464 [MAP3K7 protein results in increased expression of NFE2L2 protein] which results in decreased abundance of Reactive Oxygen Species CTD PMID:20855879 Map3k7 Rat reactive oxygen species affects abundance ISO Map3k7 (Mus musculus) 6480464 MAP3K7 protein affects the abundance of Reactive Oxygen Species CTD PMID:20855879 Map3k7 Rat reactive oxygen species decreases abundance ISO Map3k7 (Mus musculus) 6480464 MAP3K7 protein results in decreased abundance of Reactive Oxygen Species CTD PMID:20959492 Map3k7 Rat resveratrol multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of MAP3K7 mRNA CTD PMID:23557933 Map3k7 Rat rosmarinic acid decreases phosphorylation EXP 6480464 Rosmarinic Acid results in decreased phosphorylation of MAP3K7 protein CTD PMID:28789951 Map3k7 Rat satavaptan decreases phosphorylation EXP 401827158 Satavaptan decreases phosphorylation of Map3k7 protein in inner medullary collecting duct RGD Map3k7 Rat SB 431542 multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MAP3K7 mRNA CTD PMID:27188386 Map3k7 Rat selenium atom decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Selenium results in decreased expression of MAP3K7 mRNA CTD PMID:19244175 Map3k7 Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of MAP3K7 mRNA CTD PMID:32721576 Map3k7 Rat simvastatin multiple interactions ISO MAP3K7 (Homo sapiens) 6480464 Simvastatin results in decreased activity of [MAP3K7 protein co-treated with TAB1 protein] CTD PMID:17277159 Map3k7 Rat sodium arsenite increases expression ISO MAP3K7 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MAP3K7 mRNA and sodium arsenite results in increased expression of MAP3K7 protein CTD PMID:21925251 and PMID:38568856 Map3k7 Rat sodium arsenite decreases expression ISO Map3k7 (Mus musculus) 6480464 sodium arsenite results in decreased expression of MAP3K7 mRNA CTD PMID:31233874 Map3k7 Rat sodium dichromate increases expression ISO Map3k7 (Mus musculus) 6480464 sodium bichromate results in increased expression of MAP3K7 mRNA CTD PMID:22155349 Map3k7 Rat sodium fluoride increases expression ISO Map3k7 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of MAP3K7 mRNA CTD PMID:27862939 Map3k7 Rat sulfates affects methylation ISO MAP3K7 (Homo sapiens) 6480464 Sulfates affects the methylation of MAP3K7 promoter CTD PMID:25395096 Map3k7 Rat sunitinib increases expression ISO MAP3K7 (Homo sapiens) 6480464 Sunitinib results in increased expression of MAP3K7 mRNA CTD PMID:31533062 Map3k7 Rat tacrolimus hydrate increases phosphorylation ISO Map3k7 (Mus musculus) 6480464 Tacrolimus results in increased phosphorylation of MAP3K7 protein CTD PMID:23958496 Map3k7 Rat tert-butyl hydroperoxide decreases expression ISO MAP3K7 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased expression of MAP3K7 mRNA CTD PMID:15336504 Map3k7 Rat testosterone multiple interactions EXP 6480464 Testosterone promotes the reaction [Estradiol inhibits the reaction [Corticosterone results in increased phosphorylation of MAP3K7 protein]] CTD PMID:29625166 Map3k7 Rat titanium dioxide decreases methylation ISO Map3k7 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of MAP3K7 promoter CTD PMID:35295148 Map3k7 Rat toluene 2,4-diisocyanate decreases expression ISO Map3k7 (Mus musculus) 6480464 Toluene 2 and 4-Diisocyanate results in decreased expression of MAP3K7 mRNA CTD PMID:11379042 Map3k7 Rat tributylstannane increases expression EXP 6480464 tributyltin results in increased expression of MAP3K7 mRNA CTD PMID:31129395 Map3k7 Rat tributylstannane multiple interactions EXP 6480464 [bisphenol A co-treated with tributyltin] results in increased expression of MAP3K7 mRNA CTD PMID:31129395 Map3k7 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of MAP3K7 mRNA CTD PMID:33387578 Map3k7 Rat trichostatin A affects expression ISO MAP3K7 (Homo sapiens) 6480464 trichostatin A affects the expression of MAP3K7 mRNA CTD PMID:28542535 Map3k7 Rat triphenyl phosphate affects expression ISO MAP3K7 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of MAP3K7 mRNA CTD PMID:37042841 Map3k7 Rat tunicamycin increases expression ISO Map3k7 (Mus musculus) 6480464 Tunicamycin results in increased expression of MAP3K7 mRNA CTD PMID:17127020 Map3k7 Rat valproic acid decreases expression ISO Map3k7 (Mus musculus) 6480464 Valproic Acid results in decreased expression of MAP3K7 mRNA CTD PMID:21427059 Map3k7 Rat valproic acid decreases methylation ISO MAP3K7 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of MAP3K7 gene CTD PMID:29154799 Map3k7 Rat valproic acid affects expression ISO MAP3K7 (Homo sapiens) 6480464 Valproic Acid affects the expression of MAP3K7 mRNA CTD PMID:25979313 Map3k7 Rat vincristine decreases expression ISO MAP3K7 (Homo sapiens) 6480464 Vincristine results in decreased expression of MAP3K7 mRNA CTD PMID:23649840
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(+)-Erythraline (ISO) (-)-demecolcine (ISO) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dinitrotoluene (EXP) 2-Hydroxy-6-(8,11,14-pentadecatrienyl)benzoic acid (ISO) 2-hydroxypropanoic acid (ISO) 5Z-7-oxozeaenol (ISO) actinomycin D (ISO) aflatoxin B1 (ISO) AICA ribonucleotide (EXP) albiflorin (ISO) alpha-Chaconine (ISO) angiotensin II (ISO) antirheumatic drug (ISO) arjunolic acid (EXP) benzo[a]pyrene (ISO) bis(2-chloroethyl) sulfide (ISO) bis(2-ethylhexyl) phthalate (EXP) bisphenol A (EXP,ISO) cadmium atom (EXP) cadmium dichloride (EXP,ISO) camptothecin (ISO) cannabidiol (ISO) capsaicin (ISO) capsazepine (ISO) carbamazepine (ISO) carbon nanotube (ISO) casticin (ISO) CGP 52608 (ISO) cisplatin (EXP) corn oil (ISO) corticosterone (EXP) cortisol (ISO) coumarin (ISO) cyclosporin A (ISO) dextran sulfate (ISO) dibutyl phthalate (ISO) diclofenac (ISO) dihydrolipoic acid (EXP) disodium selenite (ISO) dorsomorphin (ISO) doxorubicin (EXP,ISO) elemental selenium (ISO) ethanol (ISO) fasudil (ISO) filipin III (EXP) flavokawain B (ISO) flutamide (EXP) formaldehyde (ISO) FR900359 (ISO) genistein (EXP) hexadecanoic acid (EXP) hypochlorous acid (ISO) iron atom (EXP) iron(0) (EXP) iron(2+) sulfate (anhydrous) (EXP) kaempferol (ISO) L-glutamic acid (ISO) lipopolysaccharide (ISO) maneb (ISO) manganese(II) chloride (ISO) metformin (EXP,ISO) methamphetamine (EXP) methotrexate (ISO) methylparaben (ISO) monocrotaline (EXP) myricetin (ISO) N-phosphocreatine (EXP) nickel dichloride (EXP) nonanoic acid (ISO) o-anisidine (ISO) oligomycin (EXP) olmesartan (EXP) omega-3 fatty acid (EXP) oxazepam (ISO) oxidised LDL (ISO) paclitaxel (ISO) paeoniflorin (EXP) paracetamol (ISO) paraquat (EXP,ISO) Pentoxifylline (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) phenylephrine (EXP) phenylmercury acetate (ISO) phlorizin (ISO) pirinixic acid (ISO) quercetin (ISO) rac-lactic acid (ISO) reactive oxygen species (ISO) resveratrol (ISO) rosmarinic acid (EXP) satavaptan (EXP) SB 431542 (ISO) selenium atom (ISO) silicon dioxide (EXP) simvastatin (ISO) sodium arsenite (ISO) sodium dichromate (ISO) sodium fluoride (ISO) sulfates (ISO) sunitinib (ISO) tacrolimus hydrate (ISO) tert-butyl hydroperoxide (ISO) testosterone (EXP) titanium dioxide (ISO) toluene 2,4-diisocyanate (ISO) tributylstannane (EXP) trichloroethene (EXP) trichostatin A (ISO) triphenyl phosphate (ISO) tunicamycin (ISO) valproic acid (ISO) vincristine (ISO)
Biological Process
angiogenesis (ISO) anoikis (ISO) apoptotic process (IEA) apoptotic signaling pathway (ISO) bone development (ISO) canonical NF-kappaB signal transduction (IEA,ISO) cellular response to angiotensin (IDA) cellular response to hypoxia (IEP) cellular response to transforming growth factor beta stimulus (IDA,IEP) cellular response to tumor necrosis factor (IDA) chromatin remodeling (IEA) defense response to bacterium (IEA,ISO) I-kappaB phosphorylation (ISO,ISS) immune response (IBA) inflammatory response (IEA,ISO) interleukin-1-mediated signaling pathway (IEA,ISO) interleukin-17A-mediated signaling pathway (IEA,ISO) interleukin-33-mediated signaling pathway (IEA,ISO) JNK cascade (IBA,IEA,ISO,ISS) MAPK cascade (IDA,IEA,ISO) negative regulation of apoptotic signaling pathway (ISO) negative regulation of gene expression (IMP) negative regulation of necroptotic process (ISO) negative regulation of reactive oxygen species metabolic process (ISO) negative regulation of ripoptosome assembly involved in necroptotic process (ISO) negative regulation of voltage-gated calcium channel activity (IMP) neural tube formation (ISO) osteoblast differentiation (ISO) p38MAPK cascade (IEA,ISO) positive regulation of autophagy (IMP) positive regulation of canonical NF-kappaB signal transduction (IBA,IEA,IMP,ISO) positive regulation of cell cycle (IMP) positive regulation of cell size (IMP) positive regulation of cGAS/STING signaling pathway (ISO) positive regulation of interleukin-2 production (IEA,ISO) positive regulation of JNK cascade (ISO) positive regulation of JUN kinase activity (ISO,ISS) positive regulation of macroautophagy (ISO) positive regulation of MAPK cascade (IDA) positive regulation of non-canonical NF-kappaB signal transduction (IEA,ISO) positive regulation of signal transduction (IEA) positive regulation of T cell cytokine production (IEA,ISO) positive regulation of vascular associated smooth muscle cell migration (IMP) positive regulation of vascular associated smooth muscle cell proliferation (IMP) protein phosphorylation (IDA,ISO) regulation of reactive oxygen species metabolic process (ISO) response to angiotensin (IEP) response to hypoxia (IEP) signal transduction (IEA) stress-activated MAPK cascade (IEA,ISO) toll-like receptor 4 signaling pathway (IEA,ISO) transforming growth factor beta receptor signaling pathway (ISO)
Molecular Function
ATP binding (IDA,IEA) DNA-binding transcription factor binding (IPI) enzyme binding (IEA) histone kinase activity (IDA) identical protein binding (IEA,ISO) kinase activity (IEA) linear polyubiquitin binding (IEA,ISO) magnesium ion binding (IEA) MAP kinase activity (IEA,ISO) MAP kinase kinase activity (ISO) MAP kinase kinase kinase activity (IBA,IDA,IEA,ISO,ISS) MAP kinase kinase kinase kinase activity (ISO) metal ion binding (IEA) nucleotide binding (IEA) protein binding (IPI,ISO) protein kinase activity (IEA) protein serine kinase activity (IEA) protein serine/threonine kinase activity (IEA,ISO) protein serine/threonine kinase binding (IDA) receptor tyrosine kinase binding (IEA,ISO) scaffold protein binding (IEA,ISO) transcription coactivator binding (IPI) transferase activity (IEA) type II transforming growth factor beta receptor binding (IPI) ubiquitin protein ligase binding (IPI)
1.
Arjunolic acid, a peroxisome proliferator-activated receptor α agonist, regresses cardiac fibrosis by inhibiting non-canonical TGF-β signaling.
Bansal T, etal., J Biol Chem. 2017 Oct 6;292(40):16440-16462. doi: 10.1074/jbc.M117.788299. Epub 2017 Aug 18.
2.
Tripartite Motif 8 Contributes to Pathological Cardiac Hypertrophy Through Enhancing Transforming Growth Factor β-Activated Kinase 1-Dependent Signaling Pathways.
Chen L, etal., Hypertension. 2017 Feb;69(2):249-258. doi: 10.1161/HYPERTENSIONAHA.116.07741. Epub 2016 Dec 12.
3.
Mechanisms and functions of p38 MAPK signalling.
Cuadrado A and Nebreda AR, Biochem J. 2010 Aug 1;429(3):403-17. doi: 10.1042/BJ20100323.
4.
p38 MAP-kinases pathway regulation, function and role in human diseases.
Cuenda A and Rousseau S, Biochim Biophys Acta. 2007 Aug;1773(8):1358-75. Epub 2007 Mar 24.
5.
Tumor necrosis factor receptor-associated factor-6 and ribosomal S6 kinase intracellular pathways link the angiotensin II AT1 receptor to the phosphorylation and activation of the IkappaB kinase complex in vascular smooth muscle cells.
Doyon P and Servant MJ, J Biol Chem. 2010 Oct 1;285(40):30708-18. doi: 10.1074/jbc.M110.126433. Epub 2010 Jul 21.
6.
Growth/differentiation factor 15 causes TGFβ-activated kinase 1-dependent muscle atrophy in pulmonary arterial hypertension.
Garfield BE, etal., Thorax. 2019 Feb;74(2):164-176. doi: 10.1136/thoraxjnl-2017-211440. Epub 2018 Dec 15.
7.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
8.
Erythropoietin Abrogates Post-Ischemic Activation of the NLRP3, NLRC4, and AIM2 Inflammasomes in Microglia/Macrophages in a TAK1-Dependent Manner.
Heinisch O, etal., Transl Stroke Res. 2022 Jun;13(3):462-482. doi: 10.1007/s12975-021-00948-8. Epub 2021 Oct 9.
9.
Global analysis of the effects of the V2 receptor antagonist satavaptan on protein phosphorylation in collecting duct.
Hoffert JD, etal., Am J Physiol Renal Physiol. 2014 Feb 15;306(4):410-21. doi: 10.1152/ajprenal.00497.2013. Epub 2013 Nov 20.
10.
FBXW5 acts as a negative regulator of pathological cardiac hypertrophy by decreasing the TAK1 signaling to pro-hypertrophic members of the MAPK signaling pathway.
Hui X, etal., J Mol Cell Cardiol. 2021 Feb;151:31-43. doi: 10.1016/j.yjmcc.2020.09.008. Epub 2020 Sep 22.
11.
The ubiquitin E3 ligase TRAF6 exacerbates pathological cardiac hypertrophy via TAK1-dependent signalling.
Ji YX, etal., Nat Commun. 2016 Jun 1;7:11267. doi: 10.1038/ncomms11267.
12.
The c-jun kinase/stress-activated pathway: regulation, function and role in human disease.
Johnson GL and Nakamura K, Biochim Biophys Acta. 2007 Aug;1773(8):1341-8. Epub 2007 Jan 4.
13.
Genetic mapping of allelic loss on chromosome 6q within heterogeneous prostate carcinoma.
Konishi N, etal., Cancer Sci. 2003 Sep;94(9):764-8.
14.
Pathogen recognition by the innate immune system.
Kumar H, etal., Int Rev Immunol. 2011 Feb;30(1):16-34.
15.
Modulation of AT-1R/AMPK-MAPK cascade plays crucial role for the pathogenesis of diabetic cardiomyopathy in transgenic type 2 diabetic (Spontaneous Diabetic Torii) rats.
Lakshmanan AP, etal., Biochem Pharmacol. 2012 Mar 1;83(5):653-60. doi: 10.1016/j.bcp.2011.11.018. Epub 2011 Nov 28.
16.
Heterozygous Mutations in MAP3K7, Encoding TGF-beta-Activated Kinase 1, Cause Cardiospondylocarpofacial Syndrome.
Le Goff C, etal., Am J Hum Genet. 2016 Aug 4;99(2):407-13. doi: 10.1016/j.ajhg.2016.06.005. Epub 2016 Jul 14.
17.
Farnesoid X receptor activation inhibits TGFBR1/TAK1-mediated vascular inflammation and calcification via miR-135a-5p.
Li C, etal., Commun Biol. 2020 Jun 24;3(1):327. doi: 10.1038/s42003-020-1058-2.
18.
Dual-specificity phosphatase 14 protects the heart from aortic banding-induced cardiac hypertrophy and dysfunction through inactivation of TAK1-P38MAPK/-JNK1/2 signaling pathway.
Li CY, etal., Basic Res Cardiol. 2016 Mar;111(2):19. doi: 10.1007/s00395-016-0536-7. Epub 2016 Feb 18.
19.
GCN5-mediated regulation of pathological cardiac hypertrophy via activation of the TAK1-JNK/p38 signaling pathway.
Li J, etal., Cell Death Dis. 2022 Apr 30;13(4):421. doi: 10.1038/s41419-022-04881-y.
20.
Transforming growth factor beta-activated kinase 1 signaling pathway critically regulates myocardial survival and remodeling.
Li L, etal., Circulation. 2014 Dec 9;130(24):2162-72. doi: 10.1161/CIRCULATIONAHA.114.011195. Epub 2014 Oct 2.
21.
microRNA-149-5p mediates the PM2.5-induced inflammatory response by targeting TAB2 via MAPK and NF-κB signaling pathways in vivo and in vitro.
Li Q, etal., Cell Biol Toxicol. 2021 Jul 31. pii: 10.1007/s10565-021-09638-5. doi: 10.1007/s10565-021-09638-5.
22.
Myricetin Alleviates Pathological Cardiac Hypertrophy via TRAF6/TAK1/MAPK and Nrf2 Signaling Pathway.
Liao HH, etal., Oxid Med Cell Longev. 2019 Dec 6;2019:6304058. doi: 10.1155/2019/6304058. eCollection 2019.
23.
TGF-beta1 induces cardiac hypertrophic responses via PKC-dependent ATF-2 activation.
Lim JY, etal., J Mol Cell Cardiol. 2005 Oct;39(4):627-36. doi: 10.1016/j.yjmcc.2005.06.016.
24.
Expanding role of ubiquitination in NF-kappaB signaling.
Liu S and Chen ZJ, Cell Res. 2011 Jan;21(1):6-21. Epub 2010 Dec 7.
25.
MG53, A Novel Regulator of KChIP2 and Ito,f, Plays a Critical Role in Electrophysiological Remodeling in Cardiac Hypertrophy.
Liu W, etal., Circulation. 2019 Apr 30;139(18):2142-2156. doi: 10.1161/CIRCULATIONAHA.118.029413.
26.
Deletion of a small consensus region at 6q15, including the MAP3K7 gene, is significantly associated with high-grade prostate cancers.
Liu W, etal., Clin Cancer Res. 2007 Sep 1;13(17):5028-33.
27.
Leukotriene B4 Inhibits L-Type Calcium Channels via p38 Signaling Pathway in Vascular Smooth Muscle Cells.
Liu X, etal., Cell Physiol Biochem. 2015;37(5):1903-13. doi: 10.1159/000438551. Epub 2015 Nov 17.
28.
Albiflorin Alleviates Ox-LDL-Induced Human Umbilical Vein Endothelial Cell Injury through IRAK1/TAK1 Pathway.
Liu Y, etal., Biomed Res Int. 2022 May 13;2022:6584645. doi: 10.1155/2022/6584645. eCollection 2022.
29.
Inhibition of TGFβ-activated kinase 1 promotes inflammation-resolving microglial/macrophage responses and recovery after stroke in ovariectomized female mice.
Liu Y, etal., Neurobiol Dis. 2021 Apr;151:105257. doi: 10.1016/j.nbd.2021.105257. Epub 2021 Jan 9.
30.
C1q-tumour necrosis factor-related protein-3 exacerbates cardiac hypertrophy in mice.
Ma ZG, etal., Cardiovasc Res. 2019 May 1;115(6):1067-1077. doi: 10.1093/cvr/cvy279.
31.
Biomechanical signals suppress TAK1 activation to inhibit NF-kappaB transcriptional activation in fibrochondrocytes.
Madhavan S, etal., J Immunol. 2007 Nov 1;179(9):6246-54.
32.
Activation of TGF-beta1-TAK1-p38 MAPK pathway in spared cardiomyocytes is involved in left ventricular remodeling after myocardial infarction in rats.
Matsumoto-Ida M, etal., Am J Physiol Heart Circ Physiol. 2006 Feb;290(2):H709-15. Epub 2005 Sep 23.
33.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
34.
TAK1 kinase signaling regulates embryonic angiogenesis by modulating endothelial cell survival and migration.
Morioka S, etal., Blood. 2012 Nov 1;120(18):3846-57. doi: 10.1182/blood-2012-03-416198. Epub 2012 Sep 12.
35.
BMPR-II deficiency elicits pro-proliferative and anti-apoptotic responses through the activation of TGFβ-TAK1-MAPK pathways in PAH.
Nasim MT, etal., Hum Mol Genet. 2012 Jun 1;21(11):2548-58. doi: 10.1093/hmg/dds073. Epub 2012 Mar 2.
36.
Acute inhibition of TAK1 protects against neuronal death in cerebral ischemia.
Neubert M, etal., Cell Death Differ. 2011 Sep;18(9):1521-30. doi: 10.1038/cdd.2011.29. Epub 2011 Apr 8.
37.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
38.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
39.
GOA pipeline
RGD automated data pipeline
40.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
41.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
42.
Comprehensive gene review and curation
RGD comprehensive gene curation
43.
Brain endothelial TAK1 and NEMO safeguard the neurovascular unit.
Ridder DA, etal., J Exp Med. 2015 Sep 21;212(10):1529-49. doi: 10.1084/jem.20150165. Epub 2015 Sep 7.
44.
TLR-4, IL-1R and TNF-R signaling to NF-kappaB: variations on a common theme.
Verstrepen L, etal., Cell Mol Life Sci. 2008 Oct;65(19):2964-78.
45.
Mutations in MAP3K7 that Alter the Activity of the TAK1 Signaling Complex Cause Frontometaphyseal Dysplasia.
Wade EM, etal., Am J Hum Genet. 2016 Aug 4;99(2):392-406. doi: 10.1016/j.ajhg.2016.05.024. Epub 2016 Jul 15.
46.
NG25, an inhibitor of transforming growth factor‑β‑activated kinase 1, ameliorates neuronal apoptosis in neonatal hypoxic‑ischemic rats.
Wang H, etal., Mol Med Rep. 2018 Jan;17(1):1710-1716. doi: 10.3892/mmr.2017.8024. Epub 2017 Nov 10.
47.
Transforming Growth Factor Beta-Activated Kinase 1-Dependent Microglial and Macrophage Responses Aggravate Long-Term Outcomes After Ischemic Stroke.
Wang R, etal., Stroke. 2020 Mar;51(3):975-985. doi: 10.1161/STROKEAHA.119.028398. Epub 2020 Feb 12.
48.
A direct interaction between TGFbeta activated kinase 1 and the TGFbeta type II receptor: implications for TGFbeta signalling and cardiac hypertrophy.
Watkins SJ, etal., Cardiovasc Res. 2006 Feb 1;69(2):432-9. Epub 2005 Dec 19.
49.
Interleukin-1 (IL-1) pathway.
Weber A, etal., Sci Signal. 2010 Jan 19;3(105):cm1. doi: 10.1126/scisignal.3105cm1.
50.
Olmesartan ameliorates pressure overload-induced cardiac remodeling through inhibition of TAK1/p38 signaling in mice.
Wu L, etal., Life Sci. 2016 Jan 15;145:121-6. doi: 10.1016/j.lfs.2015.12.034. Epub 2015 Dec 17.
51.
CARD3 Promotes Cerebral Ischemia-Reperfusion Injury Via Activation of TAK1.
Wu X, etal., J Am Heart Assoc. 2020 May 5;9(9):e014920. doi: 10.1161/JAHA.119.014920. Epub 2020 Apr 30.
52.
[Mobilization of Bone Marrow Mesenchymal Stem Cells Inhibits TGF-β Non-classical Pathway Against Myocardial Fibrosis in Rats].
Xia WQ, etal., Sichuan Da Xue Xue Bao Yi Xue Ban. 2020 May;51(3):344-349. doi: 10.12182/20200560503.
53.
Simvastatin ameliorates ventricular remodeling via the TGFbeta1 signaling pathway in rats following myocardial infarction.
Xiao X, etal., Mol Med Rep. 2016 Apr 25. doi: 10.3892/mmr.2016.5178.
54.
A pivotal role for endogenous TGF-beta-activated kinase-1 in the LKB1/AMP-activated protein kinase energy-sensor pathway.
Xie M, etal., Proc Natl Acad Sci U S A. 2006 Nov 14;103(46):17378-83. doi: 10.1073/pnas.0604708103. Epub 2006 Nov 3.
55.
A20 prevents obesity-induced development of cardiac dysfunction.
Xu W, etal., J Mol Med (Berl). 2018 Feb;96(2):159-172. doi: 10.1007/s00109-017-1608-3. Epub 2017 Nov 16.
56.
Sialyltransferase7A promotes angiotensin II-induced cardiomyocyte hypertrophy via HIF-1α-TAK1 signalling pathway.
Yan X, etal., Cardiovasc Res. 2020 Jan 1;116(1):114-126. doi: 10.1093/cvr/cvz064.
57.
Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells.
Yang B, etal., Biochem Biophys Res Commun. 2015 Jul 17-24;463(1-2):130-6. doi: 10.1016/j.bbrc.2015.05.047. Epub 2015 May 20.
58.
Overexpression of miR-146b-5p Ameliorates Neonatal Hypoxic Ischemic Encephalopathy by Inhibiting IRAK1/TRAF6/TAK1/NF-αB Signaling.
Yang G and Zhao Y, Yonsei Med J. 2020 Aug;61(8):660-669. doi: 10.3349/ymj.2020.61.8.660.
59.
Cardiomyocyte-Specific RIP2 Overexpression Exacerbated Pathologic Remodeling and Contributed to Spontaneous Cardiac Hypertrophy.
Yang JJ, etal., Front Cell Dev Biol. 2021 Oct 18;9:688238. doi: 10.3389/fcell.2021.688238. eCollection 2021.
60.
Creg in Hepatocytes Ameliorates Liver Ischemia/Reperfusion Injury in a TAK1-Dependent Manner in Mice.
Yang L, etal., Hepatology. 2019 Jan;69(1):294-313. doi: 10.1002/hep.30203.
61.
TAK1-AMPK Pathway in Macrophages Regulates Hypothyroid Atherosclerosis.
Yang Y, etal., Cardiovasc Drugs Ther. 2021 Jun;35(3):599-612. doi: 10.1007/s10557-020-06996-w.
62.
Inhibitory effects of omega-3 fatty acids on early brain injury after subarachnoid hemorrhage in rats: Possible involvement of G protein-coupled receptor 120/β-arrestin2/TGF-β activated kinase-1 binding protein-1 signaling pathway.
Yin J, etal., Int J Biochem Cell Biol. 2016 Jun;75:11-22. doi: 10.1016/j.biocel.2016.03.008. Epub 2016 Mar 18.
63.
Paeoniflorin attenuates monocrotaline-induced pulmonary arterial hypertension in rats by suppressing TAK1-MAPK/NF-κB pathways.
Yu M, etal., Int J Med Sci. 2022 Mar 28;19(4):681-694. doi: 10.7150/ijms.69289. eCollection 2022.
64.
RNF207 exacerbates pathological cardiac hypertrophy via post-translational modification of TAB1.
Yuan L, etal., Cardiovasc Res. 2022 Mar 30:cvac039. doi: 10.1093/cvr/cvac039.
65.
Microglial-specific depletion of TAK1 is neuroprotective in the acute phase after ischemic stroke.
Zeyen T, etal., J Mol Med (Berl). 2020 Jun;98(6):833-847. doi: 10.1007/s00109-020-01916-9. Epub 2020 May 7.
66.
TGFβ-activated Kinase 1 (TAK1) Inhibition by 5Z-7-Oxozeaenol Attenuates Early Brain Injury after Experimental Subarachnoid Hemorrhage.
Zhang D, etal., J Biol Chem. 2015 Aug 7;290(32):19900-9. doi: 10.1074/jbc.M115.636795. Epub 2015 Jun 22.
67.
TAK1 is activated in the myocardium after pressure overload and is sufficient to provoke heart failure in transgenic mice.
Zhang D, etal., Nat Med. 2000 May;6(5):556-63. doi: 10.1038/75037.
68.
The E3 ubiquitin ligase TRIM31 plays a critical role in hypertensive nephropathy by promoting proteasomal degradation of MAP3K7 in the TGF-β1 signaling pathway.
Zhang J, etal., Cell Death Differ. 2022 Mar;29(3):556-567. doi: 10.1038/s41418-021-00874-0. Epub 2021 Sep 28.
69.
TAK1 accelerates transplant arteriosclerosis in rat aortic allografts by inducing autophagy in vascular smooth muscle cells.
Zheng X, etal., Atherosclerosis. 2022 Feb;343:10-19. doi: 10.1016/j.atherosclerosis.2022.01.009. Epub 2022 Jan 19.
70.
USP4 deficiency exacerbates hepatic ischaemia/reperfusion injury via TAK1 signalling.
Zhou J, etal., Clin Sci (Lond). 2019 Jan 30;133(2):335-349. doi: 10.1042/CS20180959. Print 2019 Jan 31.
71.
Dihydrolipoic Acid Inhibits Lysosomal Rupture and NLRP3 Through Lysosome-Associated Membrane Protein-1/Calcium/Calmodulin-Dependent Protein Kinase II/TAK1 Pathways After Subarachnoid Hemorrhage in Rat.
Zhou K, etal., Stroke. 2018 Jan;49(1):175-183. doi: 10.1161/STROKEAHA.117.018593.
72.
TRAF3 mediates neuronal apoptosis in early brain injury following subarachnoid hemorrhage via targeting TAK1-dependent MAPKs and NF-κB pathways.
Zhou Y, etal., Cell Death Dis. 2021 Jan 7;12(1):10. doi: 10.1038/s41419-020-03278-z.
Map3k7 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 51,149,524 - 51,212,012 (+) NCBI GRCr8 mRatBN7.2 5 46,356,973 - 46,415,597 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 46,357,931 - 46,415,597 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 48,494,947 - 48,552,846 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 50,094,119 - 50,152,018 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 50,043,393 - 50,101,289 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 47,183,142 - 47,244,424 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 47,186,558 - 47,244,416 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 114,022,137 - 114,079,089 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 51,793,737 - 51,852,677 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 48,252,637 - 48,308,820 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 48,252,815 - 48,309,011 (+) NCBI Celera 5 45,121,067 - 45,178,378 (+) NCBI Celera Cytogenetic Map 5 q21 NCBI
MAP3K7 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 90,513,579 - 90,587,072 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 90,513,573 - 90,587,086 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 91,223,298 - 91,296,791 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 91,282,074 - 91,353,628 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 6 91,646,249 - 91,717,462 (-) NCBI Celera Cytogenetic Map 6 q15 NCBI HuRef 6 88,442,517 - 88,515,844 (-) NCBI HuRef CHM1_1 6 91,320,725 - 91,394,113 (-) NCBI CHM1_1 T2T-CHM13v2.0 6 91,725,183 - 91,798,324 (-) NCBI T2T-CHM13v2.0
Map3k7 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 31,963,659 - 32,023,470 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 31,964,097 - 32,023,467 (+) Ensembl GRCm39 Ensembl GRCm38 4 31,963,492 - 32,023,470 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 31,964,097 - 32,023,467 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 32,051,082 - 32,110,442 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 4 32,292,735 - 32,349,405 (+) NCBI MGSCv36 mm8 Celera 4 31,710,402 - 31,768,496 (+) NCBI Celera Cytogenetic Map 4 A5 NCBI cM Map 4 13.91 NCBI
Map3k7 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955411 17,177,335 - 17,229,957 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955411 17,177,335 - 17,229,957 (-) NCBI ChiLan1.0 ChiLan1.0
MAP3K7 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 110,603,908 - 110,680,269 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 108,504,996 - 108,581,339 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 88,398,329 - 88,470,926 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 91,664,263 - 91,737,468 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 91,664,263 - 91,737,468 (-) Ensembl panpan1.1 panPan2
MAP3K7 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 49,669,849 - 49,740,039 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 49,672,389 - 49,739,850 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 49,477,606 - 49,546,370 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 50,481,094 - 50,549,843 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 50,481,149 - 50,549,837 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 49,798,234 - 49,867,173 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 49,697,121 - 49,766,116 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 49,887,662 - 49,956,849 (-) NCBI UU_Cfam_GSD_1.0
Map3k7 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 84,634,746 - 84,697,875 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936510 1,772,971 - 1,837,765 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936510 1,772,971 - 1,836,075 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MAP3K7 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 58,481,956 - 58,548,057 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 58,482,046 - 58,548,087 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 65,479,754 - 65,542,430 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MAP3K7 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 13 15,284,927 - 15,360,539 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 13 15,284,923 - 15,360,832 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 191,671,798 - 191,744,917 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Map3k7
.
Predicted Target Of
Count of predictions: 904 Count of miRNA genes: 298 Interacting mature miRNAs: 384 Transcripts: ENSRNOT00000007654, ENSRNOT00000007657 Prediction methods: Microtar, Miranda Result types: miRGate_prediction
2293666 Bmd38 Bone mineral density QTL 38 4.4 femur size trait (VT:1000369) femoral neck cortical cross-sectional area (CMO:0001702) 5 8948228 53948228 Rat 1578776 Stresp18 Stress response QTL 18 2.9 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 5 27955440 72955440 Rat 1298067 Scl15 Serum cholesterol level QTL 15 4.8 0.001 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 33215665 78215665 Rat 1549845 Scl44 Serum cholesterol level QTL 44 6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 40128307 148607290 Rat 70212 Niddm25 Non-insulin dependent diabetes mellitus QTL 25 3.54 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 1 131345958 Rat 1358353 Srcrtb2 Stress Responsive Cort Basal QTL 2 3.48 0.003 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 5 18873947 74251464 Rat 1300117 Hrtrt8 Heart rate QTL 8 3.49 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 5 3844018 47869213 Rat 634305 Mamtr1 Mammary tumor resistance QTL 1 0.0001 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 12789751 113558310 Rat 1331801 Rf33 Renal function QTL 33 4.149 kidney blood vessel physiology trait (VT:0100012) absolute change in renal vascular resistance (CMO:0001900) 5 43726656 129132602 Rat 1598807 Glom12 Glomerulus QTL 12 2.7 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 5 33215665 78215665 Rat 1302786 Kidm8 Kidney mass QTL 8 28.15 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 5 33215665 78215665 Rat 6903292 Stl28 Serum triglyceride level QTL 28 2.6 0.0073 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 5 28515489 73515489 Rat 61462 Niddm10 Non-insulin dependent diabetes mellitus QTL 10 3.9 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 5 5112159 47171491 Rat 1578767 Stresp17 Stress response QTL 17 4.3 0.01 blood aldosterone amount (VT:0005346) plasma aldosterone level (CMO:0000551) 5 27955440 72955440 Rat 1641922 Alcrsp8 Alcohol response QTL 8 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 5 35189153 68564008 Rat 1641912 Alcrsp18 Alcohol response QTL 18 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 35189153 141643988 Rat 1576314 Eutr1 Estrogen induced uterine response QTL 1 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 2138965 166875058 Rat 6903306 Scl35 Serum cholesterol QTL 35 2.6 0.0073 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 28515489 73515489 Rat 1576317 Eutr2 Estrogen induced uterine response QTL 2 0.01 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 34730116 104251008 Rat 7394712 Emca13 Estrogen-induced mammary cancer QTL 13 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 9823266 99753708 Rat 1331773 Scl26 Serum cholesterol level QTL 26 3.065 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 43726656 86724018 Rat 1331771 Rf35 Renal function QTL 35 4.36965 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 729470 86724018 Rat 8662454 Vetf3 Vascular elastic tissue fragility QTL 3 27.4 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 5 2282226 69540447 Rat 2290448 Scl54 Serum cholesterol level QTL 54 2.93 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 31663789 131345958 Rat 1641903 Alcrsp3 Alcohol response QTL 3 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 12689285 57689285 Rat 1331756 Rf34 Renal function QTL 34 4.16275 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 1 90450412 Rat 8552954 Pigfal14 Plasma insulin-like growth factor 1 level QTL 14 9 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 21226744 66226744 Rat 2316959 Gluco59 Glucose level QTL 59 4.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 34944474 113558310 Rat 1600358 Mamtr5 Mammary tumor resistance QTL 5 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 18873947 63873947 Rat
AU048745
Rat Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 5 q32 UniSTS Cytogenetic Map 13 q24 UniSTS Cytogenetic Map 6 q32 UniSTS Cytogenetic Map 17 p12 UniSTS Cytogenetic Map 16 p14 UniSTS Cytogenetic Map 13 q26 UniSTS Cytogenetic Map 10 q22 UniSTS Cytogenetic Map 7 q11 UniSTS Cytogenetic Map 8 q24 UniSTS Cytogenetic Map 5 q21 UniSTS Cytogenetic Map 4 q24 UniSTS Cytogenetic Map 2 q11 UniSTS Cytogenetic Map 1 q54 UniSTS Cytogenetic Map 1 q36 UniSTS Cytogenetic Map 18 p11 UniSTS Cytogenetic Map 13 q13 UniSTS Cytogenetic Map 10 q24 UniSTS Cytogenetic Map 8 q31 UniSTS Cytogenetic Map 3 q21 UniSTS Cytogenetic Map 13 p13 UniSTS Cytogenetic Map 1 q21 UniSTS Cytogenetic Map 11 q23 UniSTS Cytogenetic Map 10 q31 UniSTS Cytogenetic Map 16 q12.2 UniSTS Cytogenetic Map 3 q24 UniSTS Cytogenetic Map 5 q36 UniSTS Cytogenetic Map 3 p13 UniSTS
BE120532
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 5 46,391,359 - 46,391,525 (+) MAPPER mRatBN7.2 Rnor_6.0 5 47,220,180 - 47,220,345 NCBI Rnor6.0 Rnor_6.0 9 114,055,103 - 114,055,268 NCBI Rnor6.0 Rnor_5.0 9 113,573,073 - 113,573,238 UniSTS Rnor5.0 Rnor_5.0 5 51,828,433 - 51,828,598 UniSTS Rnor5.0 RGSC_v3.4 5 48,286,051 - 48,286,216 UniSTS RGSC3.4 Celera 5 45,154,141 - 45,154,306 UniSTS RH 3.4 Map 5 263.39 UniSTS Cytogenetic Map 5 q21 UniSTS
RH134828
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 5 51,211,679 - 51,211,868 (+) Marker Load Pipeline mRatBN7.2 5 46,415,264 - 46,415,453 (+) MAPPER mRatBN7.2 Rnor_6.0 5 47,244,084 - 47,244,272 NCBI Rnor6.0 Rnor_6.0 9 114,079,007 - 114,079,204 NCBI Rnor6.0 Rnor_5.0 5 51,852,337 - 51,852,525 UniSTS Rnor5.0 Rnor_5.0 9 113,596,977 - 113,597,174 UniSTS Rnor5.0 RGSC_v3.4 5 48,309,955 - 48,310,143 UniSTS RGSC3.4 Celera 5 45,178,034 - 45,178,234 UniSTS RH 3.4 Map 5 260.4 UniSTS Cytogenetic Map 5 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
3
11
43
82
57
60
41
19
41
160
73
74
35
41
19
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000007654 ⟹ ENSRNOP00000007654
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 46,357,931 - 46,415,597 (+) Ensembl Rnor_6.0 Ensembl 5 47,186,558 - 47,244,416 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000007657 ⟹ ENSRNOP00000007657
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 46,357,931 - 46,415,597 (+) Ensembl Rnor_6.0 Ensembl 9 114,022,137 - 114,079,089 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000098749 ⟹ ENSRNOP00000083011
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 46,357,931 - 46,415,597 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000109648 ⟹ ENSRNOP00000090653
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 46,357,931 - 46,412,886 (+) Ensembl
RefSeq Acc Id:
NM_001107920 ⟹ NP_001101390
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 51,154,352 - 51,212,012 (+) NCBI mRatBN7.2 5 46,357,931 - 46,415,597 (+) NCBI Rnor_6.0 5 47,186,558 - 47,244,416 (+) NCBI Rnor_5.0 5 51,793,737 - 51,852,677 (+) NCBI RGSC_v3.4 5 48,252,637 - 48,308,820 (+) RGD Celera 5 45,121,067 - 45,178,378 (+) NCBI
Sequence:
GACGGAAAGCGCTGAGGAGCCGAAGCCGGGACTCGGCGGTGGCCCGGGTCGGTCCCGCGCCACGGAGCGCCGGGCGGCTGGGCTGCTGGGCTCCGGGCTGAAGGGCGGTGTGCGGGCCGGTGGGCGGG
hide sequence
RefSeq Acc Id:
XM_006237966 ⟹ XP_006238028
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 51,149,524 - 51,212,012 (+) NCBI mRatBN7.2 5 46,356,973 - 46,413,034 (+) NCBI Rnor_6.0 5 47,183,142 - 47,244,424 (+) NCBI Rnor_5.0 5 51,793,737 - 51,852,677 (+) NCBI
Sequence:
CACACAAACAGGCACCAAAAGCCAGACCTAACATTTGAGGGACCCAGAGCAAGAGTAAAGCAGA
hide sequence
RefSeq Acc Id:
XM_039109819 ⟹ XP_038965747
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 51,149,524 - 51,185,913 (+) NCBI mRatBN7.2 5 46,356,973 - 46,389,490 (+) NCBI
RefSeq Acc Id:
NP_001101390 ⟸ NM_001107920
- UniProtKB:
P0C8E4 (UniProtKB/Swiss-Prot), A0A8L2Q3A7 (UniProtKB/TrEMBL)
- Sequence:
MSTASAASSSSSSSASEMIEAPSQVLNFEEIDYKEIEVEEVVGRGAFGVVCKAKWRAKDVAIKQIESESERKAFIVELRQLSRVNHPNIVKLYGACLNPVCLVMEYAEGGSLYNVLHGAEPLPYYTAA
hide sequence
RefSeq Acc Id:
XP_006238028 ⟸ XM_006237966
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6GA73 (UniProtKB/TrEMBL), A0A8L2Q3A7 (UniProtKB/TrEMBL)
- Sequence:
MSTASAASSSSSSSASEMIEAPSQVLNFEEIDYKEIEVEEVVGRGAFGVVCKAKWRAKDVAIKQIESESERKAFIVELRQLSRVNHPNIVKLYGACLNPVCLVMEYAEGGSLYNVLHGAEPLPYYTAA
hide sequence
Ensembl Acc Id:
ENSRNOP00000007654 ⟸ ENSRNOT00000007654
RefSeq Acc Id:
XP_038965747 ⟸ XM_039109819
- Peptide Label:
isoform X2
Ensembl Acc Id:
ENSRNOP00000007657 ⟸ ENSRNOT00000007657
Ensembl Acc Id:
ENSRNOP00000090653 ⟸ ENSRNOT00000109648
Ensembl Acc Id:
ENSRNOP00000083011 ⟸ ENSRNOT00000098749
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Map3k7
mitogen activated protein kinase kinase kinase 7
LOC100910771
mitogen-activated protein kinase kinase kinase 7-like
Data merged from RGD:6496502
737654 PROVISIONAL
2012-07-05
LOC100910771
mitogen-activated protein kinase kinase kinase 7-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2008-04-30
Map3k7
mitogen activated protein kinase kinase kinase 7
Map3k7_predicted
mitogen activated protein kinase kinase kinase 7 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Map3k7_predicted
mitogen activated protein kinase kinase kinase 7 (predicted)
Symbol and Name status set to approved
70820 APPROVED
