Symbol:
Usp5
Name:
ubiquitin specific peptidase 5
RGD ID:
1308438
Description:
Predicted to enable cysteine-type deubiquitinase activity and ubiquitin binding activity. Predicted to be involved in several processes, including protein K48-linked deubiquitination; regulation of ubiquitin-dependent protein catabolic process; and regulation protein catabolic process at presynapse. Predicted to be located in presynapse. Predicted to be active in cytosol and nucleus. Orthologous to human USP5 (ubiquitin specific peptidase 5); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC100911959; LOC297593; ubiquitin carboxyl-terminal hydrolase 5; ubiquitin carboxyl-terminal hydrolase 5-like; ubiquitin specific peptidase 5 (isopeptidase T); ubiquitin specific protease 5 (isopeptidase T)
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 159,305,927 - 159,321,345 (-) NCBI GRCr8 mRatBN7.2 4 157,619,663 - 157,634,681 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 157,619,643 - 157,634,711 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 163,847,808 - 163,862,942 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 159,630,718 - 159,645,852 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 158,266,340 - 158,281,358 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 157,332,735 - 157,347,803 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 157,332,740 - 157,347,803 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 224,350,331 - 224,365,479 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 160,937,706 - 160,952,769 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 146,357,626 - 146,372,628 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Usp5 Rat (-)-epigallocatechin 3-gallate decreases expression ISO USP5 (Homo sapiens) 6480464 epigallocatechin gallate results in decreased expression of USP5 mRNA CTD PMID:18851785 Usp5 Rat 1,2-dimethylhydrazine multiple interactions ISO Usp5 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of USP5 mRNA CTD PMID:22206623 Usp5 Rat 1,2-dimethylhydrazine increases expression ISO Usp5 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of USP5 mRNA CTD PMID:22206623 Usp5 Rat 17beta-estradiol increases expression ISO Usp5 (Mus musculus) 6480464 Estradiol results in increased expression of USP5 mRNA CTD PMID:39298647 Usp5 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one affects localization ISO USP5 (Homo sapiens) 6480464 Metribolone affects the localization of USP5 protein CTD PMID:17440980 Usp5 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO USP5 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Usp5 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of USP5 mRNA CTD PMID:33387578 Usp5 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Usp5 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of USP5 mRNA CTD PMID:21346803 Usp5 Rat 2,6-dimethoxyphenol multiple interactions ISO USP5 (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Usp5 Rat 2-bromohexadecanoic acid multiple interactions ISO USP5 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of USP5 protein] CTD PMID:38195004 Usp5 Rat 2-hydroxypropanoic acid decreases expression ISO USP5 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of USP5 mRNA CTD PMID:30851411 Usp5 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Usp5 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of USP5 mRNA CTD PMID:20188158 Usp5 Rat 3-cyanoalanine multiple interactions ISO Usp5 (Mus musculus) 6480464 3-cyanoalanine inhibits the reaction [[N more ... CTD PMID:29129814 Usp5 Rat 4,4'-sulfonyldiphenol increases expression ISO Usp5 (Mus musculus) 6480464 bisphenol S results in increased expression of USP5 mRNA CTD PMID:39298647 Usp5 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of USP5 mRNA CTD PMID:36041667 Usp5 Rat 4,4'-sulfonyldiphenol decreases methylation ISO Usp5 (Mus musculus) 6480464 bisphenol S results in decreased methylation of USP5 promoter CTD PMID:33297965 Usp5 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of USP5 mRNA CTD PMID:31881176 Usp5 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of USP5 mRNA CTD PMID:28959563 Usp5 Rat actinomycin D multiple interactions ISO USP5 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of USP5 protein CTD PMID:38460933 Usp5 Rat aflatoxin B1 increases methylation ISO USP5 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of USP5 gene CTD PMID:27153756 Usp5 Rat all-trans-retinoic acid decreases expression ISO USP5 (Homo sapiens) 6480464 Tretinoin results in decreased expression of USP5 mRNA CTD PMID:33167477 Usp5 Rat arsane affects methylation ISO USP5 (Homo sapiens) 6480464 Arsenic affects the methylation of USP5 gene CTD PMID:25304211 Usp5 Rat arsenic atom affects methylation ISO USP5 (Homo sapiens) 6480464 Arsenic affects the methylation of USP5 gene CTD PMID:25304211 Usp5 Rat benzo[a]pyrene affects methylation ISO USP5 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of USP5 promoter CTD PMID:27901495 Usp5 Rat bis(2-ethylhexyl) phthalate increases expression ISO Usp5 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of USP5 mRNA CTD PMID:34319233 Usp5 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of USP5 mRNA CTD PMID:33296240 Usp5 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of USP5 mRNA CTD PMID:36041667 Usp5 Rat bisphenol A increases expression ISO USP5 (Homo sapiens) 6480464 bisphenol A results in increased expression of USP5 protein CTD PMID:37567409 Usp5 Rat bisphenol AF increases expression ISO USP5 (Homo sapiens) 6480464 bisphenol AF results in increased expression of USP5 protein CTD PMID:34186270 Usp5 Rat Bisphenol B increases expression ISO USP5 (Homo sapiens) 6480464 bisphenol B results in increased expression of USP5 protein CTD PMID:34186270 Usp5 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in increased expression of USP5 mRNA CTD PMID:36041667 Usp5 Rat bisphenol F increases expression ISO USP5 (Homo sapiens) 6480464 bisphenol F results in increased expression of USP5 protein CTD PMID:34186270 Usp5 Rat bisphenol F increases expression ISO Usp5 (Mus musculus) 6480464 bisphenol F results in increased expression of USP5 mRNA CTD PMID:38685157 Usp5 Rat bortezomib increases expression ISO Usp5 (Mus musculus) 6480464 Bortezomib results in increased expression of USP5 protein CTD PMID:30552955 Usp5 Rat Brodifacoum increases expression EXP 6480464 bromfenacoum results in increased expression of USP5 protein CTD PMID:28903499 Usp5 Rat C60 fullerene increases expression EXP 6480464 fullerene C60 results in increased expression of USP5 mRNA CTD PMID:19167457 Usp5 Rat cadmium atom multiple interactions ISO USP5 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of USP5 protein] more ... CTD PMID:35301059 and PMID:38195004 Usp5 Rat cadmium dichloride multiple interactions ISO USP5 (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of USP5 protein] more ... CTD PMID:35301059 and PMID:38195004 Usp5 Rat caffeine affects phosphorylation ISO USP5 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of USP5 protein CTD PMID:35688186 Usp5 Rat camptothecin decreases response to substance ISO USP5 (Homo sapiens) 6480464 USP5 mRNA results in decreased susceptibility to Camptothecin CTD PMID:25269479 Usp5 Rat cannabidiol increases expression ISO USP5 (Homo sapiens) 6480464 Cannabidiol results in increased expression of USP5 protein CTD PMID:34122009 Usp5 Rat capsaicin decreases expression EXP 6480464 Capsaicin results in decreased expression of USP5 mRNA CTD PMID:20349343 Usp5 Rat chlordecone increases expression ISO Usp5 (Mus musculus) 6480464 Chlordecone results in increased expression of USP5 mRNA CTD PMID:29980752 Usp5 Rat clozapine increases expression ISO USP5 (Homo sapiens) 6480464 Clozapine results in increased expression of USP5 protein CTD PMID:34122009 Usp5 Rat coumestrol increases expression ISO USP5 (Homo sapiens) 6480464 Coumestrol results in increased expression of USP5 mRNA CTD PMID:19167446 Usp5 Rat Cuprizon multiple interactions ISO USP5 (Homo sapiens) 6480464 [Cuprizone co-treated with Haloperidol] results in increased expression of USP5 protein CTD PMID:34122009 Usp5 Rat cyclophosphamide increases expression ISO Usp5 (Mus musculus) 6480464 Cyclophosphamide results in increased expression of USP5 protein CTD PMID:29129814 Usp5 Rat cyclophosphamide multiple interactions ISO Usp5 (Mus musculus) 6480464 3-cyanoalanine inhibits the reaction [[N more ... CTD PMID:29129814 Usp5 Rat Dibutyl phosphate affects expression ISO USP5 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of USP5 mRNA CTD PMID:37042841 Usp5 Rat dioxygen multiple interactions ISO Usp5 (Mus musculus) 6480464 [sulforaphane affects the susceptibility to Oxygen] which affects the expression of USP5 mRNA CTD PMID:30529165 Usp5 Rat enzyme inhibitor multiple interactions ISO USP5 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of USP5 protein CTD PMID:23301498 Usp5 Rat epoxiconazole decreases expression ISO Usp5 (Mus musculus) 6480464 epoxiconazole results in decreased expression of USP5 mRNA CTD PMID:35436446 Usp5 Rat ethanol affects splicing ISO Usp5 (Mus musculus) 6480464 Ethanol affects the splicing of USP5 mRNA CTD PMID:30319688 Usp5 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of USP5 mRNA CTD PMID:24793618 Usp5 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of USP5 mRNA CTD PMID:24136188 Usp5 Rat folic acid multiple interactions ISO Usp5 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of USP5 mRNA CTD PMID:22206623 Usp5 Rat FR900359 affects phosphorylation ISO USP5 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of USP5 protein CTD PMID:37730182 Usp5 Rat furfural multiple interactions ISO USP5 (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Usp5 Rat gold atom decreases expression ISO Usp5 (Mus musculus) 6480464 Gold analog results in decreased expression of USP5 protein CTD PMID:24780912 Usp5 Rat gold(0) decreases expression ISO Usp5 (Mus musculus) 6480464 Gold analog results in decreased expression of USP5 protein CTD PMID:24780912 Usp5 Rat GSK-J4 decreases expression ISO USP5 (Homo sapiens) 6480464 GSK-J4 results in decreased expression of USP5 mRNA CTD PMID:29301935 Usp5 Rat haloperidol multiple interactions ISO USP5 (Homo sapiens) 6480464 [Cuprizone co-treated with Haloperidol] results in increased expression of USP5 protein CTD PMID:34122009 Usp5 Rat haloperidol increases expression ISO USP5 (Homo sapiens) 6480464 Haloperidol results in increased expression of USP5 protein CTD PMID:34122009 Usp5 Rat inulin multiple interactions ISO Usp5 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of USP5 mRNA CTD PMID:36331819 Usp5 Rat ivermectin decreases expression ISO USP5 (Homo sapiens) 6480464 Ivermectin results in decreased expression of USP5 protein CTD PMID:32959892 Usp5 Rat lovastatin decreases expression ISO Usp5 (Mus musculus) 6480464 Lovastatin results in decreased expression of USP5 mRNA CTD PMID:20493250 Usp5 Rat methylazoxymethanol increases expression ISO Usp5 (Mus musculus) 6480464 methylazoxymethanol results in increased expression of USP5 mRNA CTD PMID:17107856 Usp5 Rat N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine multiple interactions ISO Usp5 (Mus musculus) 6480464 3-cyanoalanine inhibits the reaction [[N more ... CTD PMID:29129814 Usp5 Rat N-methyl-4-phenylpyridinium increases expression ISO Usp5 (Mus musculus) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of USP5 protein CTD PMID:26558463 Usp5 Rat nefazodone increases expression EXP 6480464 nefazodone results in increased expression of USP5 mRNA CTD PMID:24136188 Usp5 Rat nimesulide increases expression EXP 6480464 nimesulide results in increased expression of USP5 mRNA CTD PMID:24136188 Usp5 Rat nitrates multiple interactions ISO Usp5 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of USP5 mRNA CTD PMID:35964746 Usp5 Rat Nutlin-3 multiple interactions ISO USP5 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of USP5 protein CTD PMID:38460933 Usp5 Rat ozone multiple interactions ISO USP5 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of USP5 mRNA CTD PMID:35430440 Usp5 Rat paclitaxel decreases expression ISO USP5 (Homo sapiens) 6480464 Paclitaxel results in decreased expression of USP5 mRNA CTD PMID:15000894 Usp5 Rat paracetamol affects expression ISO Usp5 (Mus musculus) 6480464 Acetaminophen affects the expression of USP5 mRNA CTD PMID:17562736 Usp5 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of USP5 mRNA CTD PMID:33387578 Usp5 Rat pentachlorophenol increases expression ISO Usp5 (Mus musculus) 6480464 Pentachlorophenol results in increased expression of USP5 mRNA CTD PMID:23892564 Usp5 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Usp5 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of USP5 mRNA CTD PMID:36331819 Usp5 Rat piperonyl butoxide increases expression EXP 6480464 Piperonyl Butoxide results in increased expression of USP5 mRNA CTD PMID:22484513 Usp5 Rat pirinixic acid increases expression ISO Usp5 (Mus musculus) 6480464 pirinixic acid results in increased expression of USP5 mRNA CTD PMID:21318169 Usp5 Rat pirinixic acid multiple interactions ISO Usp5 (Mus musculus) 6480464 PPARA protein affects the reaction [pirinixic acid results in increased expression of USP5 mRNA] CTD PMID:21318169 Usp5 Rat rac-lactic acid decreases expression ISO USP5 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of USP5 mRNA CTD PMID:30851411 Usp5 Rat raloxifene decreases expression ISO Usp5 (Mus musculus) 6480464 Raloxifene Hydrochloride results in decreased expression of USP5 mRNA CTD PMID:33269387 Usp5 Rat SB 431542 multiple interactions ISO USP5 (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide co-treated with FGF2 protein] results in increased expression of USP5 protein CTD PMID:37664457 Usp5 Rat sodium arsenite affects methylation ISO USP5 (Homo sapiens) 6480464 sodium arsenite affects the methylation of USP5 gene CTD PMID:28589171 Usp5 Rat sodium arsenite increases expression ISO USP5 (Homo sapiens) 6480464 sodium arsenite results in increased expression of USP5 mRNA CTD PMID:34032870 Usp5 Rat sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of USP5 protein CTD PMID:29459688 Usp5 Rat sodium chloride multiple interactions ISO USP5 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of USP5 protein more ... CTD PMID:38598786 Usp5 Rat sulforaphane multiple interactions ISO Usp5 (Mus musculus) 6480464 [sulforaphane affects the susceptibility to Oxygen] which affects the expression of USP5 mRNA CTD PMID:30529165 Usp5 Rat sunitinib decreases expression ISO USP5 (Homo sapiens) 6480464 Sunitinib results in decreased expression of USP5 mRNA CTD PMID:31533062 Usp5 Rat temozolomide decreases expression ISO USP5 (Homo sapiens) 6480464 Temozolomide results in decreased expression of USP5 mRNA CTD PMID:31758290 Usp5 Rat testosterone decreases expression ISO USP5 (Homo sapiens) 6480464 Testosterone results in decreased expression of USP5 mRNA CTD PMID:33359661 Usp5 Rat titanium dioxide decreases methylation ISO Usp5 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of USP5 gene and titanium dioxide results in decreased methylation of USP5 promoter alternative form CTD PMID:35295148 Usp5 Rat trimellitic anhydride increases expression ISO Usp5 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of USP5 mRNA CTD PMID:19042947 Usp5 Rat triptonide affects expression ISO Usp5 (Mus musculus) 6480464 triptonide affects the expression of USP5 mRNA CTD PMID:33045310 Usp5 Rat valdecoxib increases expression EXP 6480464 valdecoxib results in increased expression of USP5 mRNA CTD PMID:24136188 Usp5 Rat valproic acid decreases expression ISO USP5 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of USP5 mRNA CTD PMID:29154799 Usp5 Rat valproic acid increases methylation ISO USP5 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of USP5 gene CTD PMID:29154799 Usp5 Rat warfarin decreases expression ISO Usp5 (Mus musculus) 6480464 Warfarin results in decreased expression of USP5 mRNA CTD PMID:20493250 Usp5 Rat zearalenone decreases expression ISO Usp5 (Mus musculus) 6480464 Zearalenone results in decreased expression of USP5 protein CTD PMID:36252740
(-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,4-dinitrotoluene (EXP) 2,6-dimethoxyphenol (ISO) 2-bromohexadecanoic acid (ISO) 2-hydroxypropanoic acid (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-cyanoalanine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) acetamide (EXP) acrylamide (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) arsane (ISO) arsenic atom (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (EXP,ISO) bortezomib (ISO) Brodifacoum (EXP) C60 fullerene (EXP) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) camptothecin (ISO) cannabidiol (ISO) capsaicin (EXP) chlordecone (ISO) clozapine (ISO) coumestrol (ISO) Cuprizon (ISO) cyclophosphamide (ISO) Dibutyl phosphate (ISO) dioxygen (ISO) enzyme inhibitor (ISO) epoxiconazole (ISO) ethanol (ISO) flutamide (EXP) folic acid (ISO) FR900359 (ISO) furfural (ISO) gold atom (ISO) gold(0) (ISO) GSK-J4 (ISO) haloperidol (ISO) inulin (ISO) ivermectin (ISO) lovastatin (ISO) methylazoxymethanol (ISO) N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (ISO) N-methyl-4-phenylpyridinium (ISO) nefazodone (EXP) nimesulide (EXP) nitrates (ISO) Nutlin-3 (ISO) ozone (ISO) paclitaxel (ISO) paracetamol (EXP,ISO) pentachlorophenol (ISO) perfluorooctane-1-sulfonic acid (ISO) piperonyl butoxide (EXP) pirinixic acid (ISO) rac-lactic acid (ISO) raloxifene (ISO) SB 431542 (ISO) sodium arsenite (EXP,ISO) sodium chloride (ISO) sulforaphane (ISO) sunitinib (ISO) temozolomide (ISO) testosterone (ISO) titanium dioxide (ISO) trimellitic anhydride (ISO) triptonide (ISO) valdecoxib (EXP) valproic acid (ISO) warfarin (ISO) zearalenone (ISO)
Usp5 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 159,305,927 - 159,321,345 (-) NCBI GRCr8 mRatBN7.2 4 157,619,663 - 157,634,681 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 157,619,643 - 157,634,711 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 163,847,808 - 163,862,942 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 159,630,718 - 159,645,852 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 158,266,340 - 158,281,358 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 157,332,735 - 157,347,803 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 157,332,740 - 157,347,803 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 224,350,331 - 224,365,479 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 160,937,706 - 160,952,769 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 146,357,626 - 146,372,628 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
USP5 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 6,852,150 - 6,866,632 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 6,852,148 - 6,866,632 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 6,961,314 - 6,975,796 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 6,831,546 - 6,846,057 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 6,831,583 - 6,846,054 NCBI Celera 12 8,578,571 - 8,593,082 (+) NCBI Celera Cytogenetic Map 12 p13.31 NCBI HuRef 12 6,815,013 - 6,829,524 (+) NCBI HuRef CHM1_1 12 6,960,283 - 6,974,794 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 6,861,449 - 6,875,929 (+) NCBI T2T-CHM13v2.0
Usp5 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 124,791,982 - 124,806,404 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 124,791,982 - 124,806,447 (-) Ensembl GRCm39 Ensembl GRCm38 6 124,815,019 - 124,829,484 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 124,815,019 - 124,829,484 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 124,765,037 - 124,779,465 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 124,780,638 - 124,795,066 (-) NCBI MGSCv36 mm8 Celera 6 126,491,148 - 126,505,576 (-) NCBI Celera Cytogenetic Map 6 F2 NCBI cM Map 6 59.17 NCBI
Usp5 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 4,451,622 - 4,466,832 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 4,451,530 - 4,466,832 (+) NCBI ChiLan1.0 ChiLan1.0
USP5 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 12,414,488 - 12,429,794 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 12,411,246 - 12,426,552 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 6,983,941 - 6,998,469 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 6,895,416 - 6,909,936 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 6,895,416 - 6,909,936 (+) Ensembl panpan1.1 panPan2
USP5 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 38,158,850 - 38,172,689 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 38,158,834 - 38,172,071 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 8,444,116 - 8,457,897 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 38,511,741 - 38,525,542 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 38,511,746 - 38,524,959 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 38,385,805 - 38,399,013 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 38,426,829 - 38,440,619 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 7,922,848 - 7,936,630 (+) NCBI UU_Cfam_GSD_1.0
Usp5
USP5 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 63,843,745 - 63,858,716 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 63,843,742 - 63,858,835 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 66,279,250 - 66,294,259 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
USP5 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 6,885,401 - 6,899,983 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 6,885,311 - 6,898,442 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666063 1,323,576 - 1,338,147 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Usp5
.
Predicted Target Of
Count of predictions: 272 Count of miRNA genes: 167 Interacting mature miRNAs: 186 Transcripts: ENSRNOT00000020785 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1581574 Eae20 Experimental allergic encephalomyelitis QTL 20 7.8 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 153031106 158841762 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
AI411387
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 157,619,843 - 157,620,056 (-) MAPPER mRatBN7.2 mRatBN7.2 4 157,619,843 - 157,620,056 (+) MAPPER mRatBN7.2 Rnor_6.0 4 157,332,936 - 157,333,148 NCBI Rnor6.0 Rnor_6.0 9 20,212,509 - 20,212,721 NCBI Rnor6.0 Rnor_5.0 4 224,350,532 - 224,350,744 UniSTS Rnor5.0 Rnor_5.0 9 19,088,485 - 19,088,697 UniSTS Rnor5.0 RGSC_v3.4 4 160,937,902 - 160,938,114 UniSTS RGSC3.4 Celera 4 146,357,822 - 146,358,034 UniSTS RH 3.4 Map 4 1005.8 UniSTS Cytogenetic Map 4 q42 UniSTS
MARC_7181-7182:996687603:1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 157,622,121 - 157,622,508 (-) MAPPER mRatBN7.2 mRatBN7.2 4 157,622,121 - 157,622,508 (+) MAPPER mRatBN7.2 Rnor_6.0 9 20,210,057 - 20,210,443 NCBI Rnor6.0 Rnor_6.0 4 157,335,214 - 157,335,600 NCBI Rnor6.0 Rnor_5.0 9 19,086,033 - 19,086,419 UniSTS Rnor5.0 Rnor_5.0 4 224,352,810 - 224,353,196 UniSTS Rnor5.0 RGSC_v3.4 4 160,940,180 - 160,940,566 UniSTS RGSC3.4 Celera 4 146,360,100 - 146,360,486 UniSTS Cytogenetic Map 4 q42 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000020785 ⟹ ENSRNOP00000020785
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 157,619,648 - 157,634,711 (-) Ensembl Rnor_6.0 Ensembl 4 157,332,740 - 157,347,803 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000109840 ⟹ ENSRNOP00000078694
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 157,619,643 - 157,634,711 (-) Ensembl
RefSeq Acc Id:
NM_001106619 ⟹ NP_001100089
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,305,938 - 159,320,956 (-) NCBI mRatBN7.2 4 157,619,663 - 157,634,681 (-) NCBI Rnor_6.0 4 157,332,740 - 157,347,803 (-) NCBI Rnor_5.0 4 224,350,331 - 224,365,479 (-) NCBI RGSC_v3.4 4 160,937,706 - 160,952,769 (-) RGD Celera 4 146,357,626 - 146,372,628 (-) RGD
Sequence:
ATTGGACGCGGCTGCGGTGGGGGGGGGGTACTAGGTACAGTGGGAGCTGCCGTGTGAGGAGGAGCTGCTGCCGGTGTCATGGCGGAGCTGAGTGAGGAGGCGCTGCTGTCAGTGTTACCGACGATCCG
hide sequence
RefSeq Acc Id:
NM_001394369 ⟹ NP_001381298
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,305,938 - 159,320,956 (-) NCBI mRatBN7.2 4 157,619,663 - 157,634,681 (-) NCBI
RefSeq Acc Id:
XM_063285907 ⟹ XP_063141977
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 159,305,927 - 159,321,345 (-) NCBI
RefSeq Acc Id:
NP_001100089 ⟸ NM_001106619
- Peptide Label:
isoform 1
- UniProtKB:
D3ZVQ0 (UniProtKB/TrEMBL), A6ILL7 (UniProtKB/TrEMBL), A0A8I5ZLA4 (UniProtKB/TrEMBL)
- Sequence:
MAELSEEALLSVLPTIRVPKAGDRVHKDECAFSFDTPESEGGLYICMNTFLGFGKQYVERHFNKTGQRVYLHLRRTRRPKEEDSSAGTGDPPRKKPTRLAIGVEGGFDLTEDKFEYDEDVKIVILPDY
hide sequence
Ensembl Acc Id:
ENSRNOP00000020785 ⟸ ENSRNOT00000020785
Ensembl Acc Id:
ENSRNOP00000078694 ⟸ ENSRNOT00000109840
RefSeq Acc Id:
NP_001381298 ⟸ NM_001394369
- Peptide Label:
isoform 2
- UniProtKB:
A0A8I5ZLA4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141977 ⟸ XM_063285907
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZLA4 (UniProtKB/TrEMBL)
RGD ID: 13693391 Promoter ID: EPDNEW_R3916 Type: initiation region Name: Usp5_1 Description: ubiquitin specific peptidase 5 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 157,347,773 - 157,347,833 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Usp5
ubiquitin specific peptidase 5
LOC100911959
ubiquitin carboxyl-terminal hydrolase 5-like
Data merged from RGD:6489834
737654 PROVISIONAL
2016-04-13
Usp5
ubiquitin specific peptidase 5
Usp5
ubiquitin specific peptidase 5 (isopeptidase T)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-07-05
LOC100911959
ubiquitin carboxyl-terminal hydrolase 5-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2008-03-04
Usp5
ubiquitin specific peptidase 5 (isopeptidase T)
Usp5_predicted
ubiquitin specific protease 5 (isopeptidase T) (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-12
Usp5_predicted
ubiquitin specific protease 5 (isopeptidase T) (predicted)
Symbol and Name status set to approved
70820 APPROVED
