Symbol:
Usp39
Name:
ubiquitin specific peptidase 39
RGD ID:
1308103
Description:
Predicted to enable zinc ion binding activity. Predicted to be involved in spliceosomal complex assembly. Predicted to be located in nucleoplasm. Predicted to be part of U4/U6 x U5 tri-snRNP complex. Orthologous to human USP39 (ubiquitin specific peptidase 39); PARTICIPATES IN spliceosome pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC297336; U4/U6.U5 tri-snRNP-associated protein 2; ubiquitin carboxyl-terminal hydrolase 39; ubiquitin specific protease 39
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 105,932,140 - 105,964,551 (-) NCBI GRCr8 mRatBN7.2 4 104,373,948 - 104,406,359 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,373,955 - 104,406,359 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 109,754,240 - 109,786,619 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,529,358 - 105,561,736 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,143,607 - 104,176,020 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,181,408 - 100,211,425 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,181,455 - 100,213,858 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 164,952,169 - 164,982,100 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 105,623,922 - 105,650,275 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 105,868,446 - 105,900,853 (-) NCBI Celera 4 93,527,956 - 93,554,280 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Usp39 Rat 1,2-dimethylhydrazine increases expression ISO Usp39 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of USP39 mRNA CTD PMID:22206623 Usp39 Rat 17alpha-ethynylestradiol increases expression ISO Usp39 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of USP39 mRNA CTD PMID:17942748 Usp39 Rat 17alpha-ethynylestradiol multiple interactions ISO Usp39 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of USP39 mRNA CTD PMID:17942748 Usp39 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Usp39 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of USP39 mRNA CTD PMID:17942748 Usp39 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of USP39 mRNA CTD PMID:33387578 Usp39 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO USP39 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin affects the expression of USP39 mRNA CTD PMID:22574217 Usp39 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Usp39 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of USP39 mRNA CTD PMID:21570461 Usp39 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of USP39 mRNA CTD PMID:21346803 Usp39 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of USP39 mRNA CTD PMID:21346803 Usp39 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO USP39 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of USP39 mRNA CTD PMID:28628672 Usp39 Rat 4,4'-sulfonyldiphenol increases expression ISO Usp39 (Mus musculus) 6480464 bisphenol S results in increased expression of USP39 mRNA CTD PMID:39298647 Usp39 Rat 4-amino-2,6-dinitrotoluene affects expression EXP 6480464 4-amino-2 and 6-dinitrotoluene affects the expression of USP39 mRNA CTD PMID:21346803 Usp39 Rat acrolein multiple interactions ISO USP39 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of USP39 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of USP39 mRNA CTD PMID:32699268 Usp39 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of USP39 mRNA CTD PMID:28959563 Usp39 Rat acrylamide increases expression ISO USP39 (Homo sapiens) 6480464 Acrylamide results in increased expression of USP39 mRNA CTD PMID:32763439 Usp39 Rat all-trans-retinoic acid decreases expression ISO Usp39 (Mus musculus) 6480464 Tretinoin results in decreased expression of USP39 mRNA CTD PMID:16604517 Usp39 Rat all-trans-retinoic acid decreases expression ISO USP39 (Homo sapiens) 6480464 Tretinoin results in decreased expression of USP39 mRNA CTD PMID:33167477 Usp39 Rat alpha-pinene multiple interactions ISO USP39 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of USP39 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of USP39 mRNA CTD PMID:32699268 Usp39 Rat arsenite(3-) multiple interactions ISO USP39 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to USP39 mRNA] CTD PMID:32406909 Usp39 Rat benzo[a]pyrene increases expression ISO Usp39 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of USP39 mRNA CTD PMID:22228805 Usp39 Rat beta-lapachone decreases expression ISO USP39 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of USP39 mRNA CTD PMID:38218311 Usp39 Rat beta-lapachone increases expression ISO USP39 (Homo sapiens) 6480464 beta-lapachone results in increased expression of USP39 mRNA CTD PMID:38218311 Usp39 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of USP39 mRNA CTD PMID:25181051 more ... Usp39 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of USP39 mRNA CTD PMID:34947998 Usp39 Rat bisphenol A decreases expression ISO USP39 (Homo sapiens) 6480464 bisphenol A results in decreased expression of USP39 mRNA CTD PMID:29275510 Usp39 Rat bisphenol A multiple interactions ISO USP39 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of USP39 mRNA CTD PMID:28628672 Usp39 Rat bisphenol AF increases expression ISO USP39 (Homo sapiens) 6480464 bisphenol AF results in increased expression of USP39 protein CTD PMID:34186270 Usp39 Rat cadmium atom decreases expression ISO Usp39 (Mus musculus) 6480464 Cadmium results in decreased expression of USP39 mRNA CTD PMID:24067728 Usp39 Rat cadmium dichloride decreases expression ISO USP39 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of USP39 mRNA CTD PMID:38568856 Usp39 Rat carbon nanotube increases expression ISO Usp39 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Usp39 Rat CGP 52608 multiple interactions ISO USP39 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to USP39 gene] CTD PMID:28238834 Usp39 Rat cisplatin multiple interactions ISO USP39 (Homo sapiens) 6480464 TP53 protein inhibits the reaction [USP39 protein inhibits the reaction [Cisplatin results in increased abundance of Reactive Oxygen Species]] more ... CTD PMID:34822033 Usp39 Rat cisplatin decreases response to substance ISO USP39 (Homo sapiens) 6480464 USP39 protein results in decreased susceptibility to Cisplatin CTD PMID:34822033 Usp39 Rat deoxynivalenol decreases phosphorylation ISO Usp39 (Mus musculus) 6480464 deoxynivalenol results in decreased phosphorylation of USP39 protein CTD PMID:23352502 Usp39 Rat dexamethasone multiple interactions ISO USP39 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of USP39 mRNA CTD PMID:28628672 Usp39 Rat Dibutyl phosphate affects expression ISO USP39 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of USP39 mRNA CTD PMID:37042841 Usp39 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of USP39 mRNA CTD PMID:24136188 Usp39 Rat FR900359 increases phosphorylation ISO USP39 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of USP39 protein CTD PMID:37730182 Usp39 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of USP39 mRNA CTD PMID:22061828 and PMID:33387578 Usp39 Rat indometacin multiple interactions ISO USP39 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of USP39 mRNA CTD PMID:28628672 Usp39 Rat ivermectin decreases expression ISO USP39 (Homo sapiens) 6480464 Ivermectin results in decreased expression of USP39 protein CTD PMID:32959892 Usp39 Rat lead(0) decreases expression ISO USP39 (Homo sapiens) 6480464 Lead results in decreased expression of USP39 mRNA CTD PMID:19921347 Usp39 Rat mercury atom increases expression ISO USP39 (Homo sapiens) 6480464 Mercury results in increased expression of USP39 mRNA CTD PMID:16823088 Usp39 Rat mercury(0) increases expression ISO USP39 (Homo sapiens) 6480464 Mercury results in increased expression of USP39 mRNA CTD PMID:16823088 Usp39 Rat methyl methanesulfonate increases expression ISO USP39 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of USP39 mRNA CTD PMID:23649840 Usp39 Rat N-methyl-4-phenylpyridinium increases expression ISO Usp39 (Mus musculus) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of USP39 protein CTD PMID:26558463 Usp39 Rat nefazodone increases expression EXP 6480464 nefazodone results in increased expression of USP39 mRNA CTD PMID:24136188 Usp39 Rat nimesulide increases expression EXP 6480464 nimesulide results in increased expression of USP39 mRNA CTD PMID:24136188 Usp39 Rat ozone multiple interactions ISO USP39 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of USP39 mRNA more ... CTD PMID:32699268 Usp39 Rat paracetamol affects expression ISO Usp39 (Mus musculus) 6480464 Acetaminophen affects the expression of USP39 mRNA CTD PMID:17562736 Usp39 Rat perfluorooctane-1-sulfonic acid decreases expression ISO Usp39 (Mus musculus) 6480464 perfluorooctane sulfonic acid results in decreased expression of USP39 protein CTD PMID:26178269 Usp39 Rat pirinixic acid decreases expression ISO Usp39 (Mus musculus) 6480464 pirinixic acid results in decreased expression of USP39 mRNA CTD PMID:21318169 Usp39 Rat pirinixic acid multiple interactions ISO Usp39 (Mus musculus) 6480464 PPARA protein affects the reaction [pirinixic acid results in decreased expression of USP39 mRNA] CTD PMID:21318169 Usp39 Rat reactive oxygen species multiple interactions ISO USP39 (Homo sapiens) 6480464 TP53 protein inhibits the reaction [USP39 protein inhibits the reaction [Cisplatin results in increased abundance of Reactive Oxygen Species]] and USP39 protein inhibits the reaction [Cisplatin results in increased abundance of Reactive Oxygen Species] CTD PMID:34822033 Usp39 Rat resveratrol multiple interactions ISO USP39 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of USP39 mRNA CTD PMID:23557933 Usp39 Rat sodium arsenite affects expression ISO USP39 (Homo sapiens) 6480464 sodium arsenite affects the expression of USP39 mRNA CTD PMID:29319823 Usp39 Rat sodium arsenite decreases expression ISO USP39 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of USP39 mRNA CTD PMID:38568856 Usp39 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of USP39 mRNA CTD PMID:31150632 Usp39 Rat tetrachloromethane increases expression ISO Usp39 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of USP39 mRNA CTD PMID:31919559 Usp39 Rat trimellitic anhydride increases expression ISO Usp39 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of USP39 mRNA CTD PMID:19042947 Usp39 Rat Triptolide increases expression EXP 6480464 triptolide results in increased expression of USP39 protein CTD PMID:32519852 Usp39 Rat trovafloxacin decreases expression ISO Usp39 (Mus musculus) 6480464 trovafloxacin results in decreased expression of USP39 mRNA CTD PMID:35537566 Usp39 Rat valproic acid affects expression ISO Usp39 (Mus musculus) 6480464 Valproic Acid affects the expression of USP39 mRNA CTD PMID:17292431
Imported Annotations - KEGG (archival)
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 4-amino-2,6-dinitrotoluene (EXP) acrolein (ISO) acrylamide (EXP,ISO) all-trans-retinoic acid (ISO) alpha-pinene (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) cadmium atom (ISO) cadmium dichloride (ISO) carbon nanotube (ISO) CGP 52608 (ISO) cisplatin (ISO) deoxynivalenol (ISO) dexamethasone (ISO) Dibutyl phosphate (ISO) flutamide (EXP) FR900359 (ISO) gentamycin (EXP) indometacin (ISO) ivermectin (ISO) lead(0) (ISO) mercury atom (ISO) mercury(0) (ISO) methyl methanesulfonate (ISO) N-methyl-4-phenylpyridinium (ISO) nefazodone (EXP) nimesulide (EXP) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) pirinixic acid (ISO) reactive oxygen species (ISO) resveratrol (ISO) sodium arsenite (ISO) tetrachloromethane (EXP,ISO) trimellitic anhydride (ISO) Triptolide (EXP) trovafloxacin (ISO) valproic acid (ISO)
Usp39 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 105,932,140 - 105,964,551 (-) NCBI GRCr8 mRatBN7.2 4 104,373,948 - 104,406,359 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,373,955 - 104,406,359 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 109,754,240 - 109,786,619 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,529,358 - 105,561,736 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,143,607 - 104,176,020 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,181,408 - 100,211,425 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,181,455 - 100,213,858 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 164,952,169 - 164,982,100 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 105,623,922 - 105,650,275 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 105,868,446 - 105,900,853 (-) NCBI Celera 4 93,527,956 - 93,554,280 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
USP39 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 85,602,861 - 85,649,283 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 85,602,856 - 85,649,283 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 85,829,984 - 85,876,406 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 85,696,794 - 85,729,917 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 85,754,940 - 85,788,063 NCBI Celera 2 85,671,566 - 85,704,705 (+) NCBI Celera Cytogenetic Map 2 p11.2 NCBI HuRef 2 85,727,104 - 85,773,387 (+) NCBI HuRef CHM1_1 2 85,759,771 - 85,806,166 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 85,604,921 - 85,651,339 (+) NCBI T2T-CHM13v2.0
Usp39 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 72,295,749 - 72,322,190 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 72,295,661 - 72,322,167 (-) Ensembl GRCm39 Ensembl GRCm38 6 72,318,676 - 72,345,208 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 72,318,678 - 72,345,184 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 72,268,670 - 72,295,169 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 72,248,185 - 72,274,684 (-) NCBI MGSCv36 mm8 Celera 6 74,408,796 - 74,435,299 (-) NCBI Celera Cytogenetic Map 6 C1 NCBI cM Map 6 32.27 NCBI
Usp39 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 1,867,850 - 1,894,157 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 1,867,910 - 1,893,338 (-) NCBI ChiLan1.0 ChiLan1.0
USP39 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 40,733,638 - 40,779,733 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 40,736,399 - 40,782,484 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 85,655,633 - 85,701,775 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 87,219,121 - 87,251,931 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 87,215,366 - 87,251,931 (+) Ensembl panpan1.1 panPan2
USP39 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 17 39,437,908 - 39,470,579 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 17 39,438,329 - 39,470,549 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 17 39,109,745 - 39,141,965 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 17 40,184,513 - 40,217,215 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 17 40,184,513 - 40,217,432 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 17 39,314,066 - 39,346,743 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 17 39,386,575 - 39,418,768 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 17 39,785,977 - 39,818,386 (-) NCBI UU_Cfam_GSD_1.0
Usp39 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 79,196,882 - 79,233,019 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936712 1,625,802 - 1,661,533 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936712 1,625,429 - 1,661,561 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
USP39 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 59,121,048 - 59,156,442 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 59,121,381 - 59,156,597 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 62,195,078 - 62,215,382 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
USP39 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 21,507,666 - 21,554,819 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 21,508,104 - 21,541,553 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 90,913,997 - 90,971,480 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Usp39
.
Predicted Target Of
Count of predictions: 95 Count of miRNA genes: 83 Interacting mature miRNAs: 88 Transcripts: ENSRNOT00000015562 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 631689 Scl4 Serum cholesterol level QTL 4 1.9 0.008 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 95174120 140174120 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1578655 Bmd11 Bone mineral density QTL 11 11 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 4 90850165 135850165 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 1357342 Bw40 Body weight QTL 40 0.001 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 631556 Bp135 Blood pressure QTL 135 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 78881294 117676292 Rat 61330 Eau1 Experimental allergic uveoretinitis QTL 1 0.0003 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 4 70362013 132642728 Rat 70167 Bw22 Body weight QTL 22 3.1 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 1549839 Bw52 Body weight QTL 52 0.0001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 61697658 115089733 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 724522 Bp146 Blood pressure QTL 146 2.2 0.0021 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 73630210 118630210 Rat 61476 Aia3 Adjuvant induced arthritis QTL 3 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 86730991 131730991 Rat 1641919 Alc22 Alcohol consumption QTL 22 0.0005 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 81192555 126192555 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 2300179 Bmd50 Bone mineral density QTL 50 5.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 4 60928534 105928534 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 70192 BpQTLcluster5 Blood pressure QTL cluster 5 4.183 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 4 62933508 114921294 Rat 1578670 Bss14 Bone structure and strength QTL 14 16.4 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 4 87327165 132327165 Rat 2317588 Eae27 Experimental allergic encephalomyelitis QTL 27 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 103194805 112478794 Rat 1300139 Hrtrt6 Heart rate QTL 6 2.85 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 39524264 116179656 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 1578657 Bss12 Bone structure and strength QTL 12 8.9 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 4 60220938 105220938 Rat 1578658 Bss13 Bone structure and strength QTL 13 8 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 4 60220938 105220938 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478684 Anxrr30 Anxiety related response QTL 30 0.00087 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 1578662 Bss15 Bone structure and strength QTL 15 19.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 4 87327165 132327165 Rat 2302051 Pia28 Pristane induced arthritis QTL 28 5.3 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 73630210 118630210 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 738015 Pia9 Pristane induced arthritis QTL 9 4.5 0.048 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 80694870 125694870 Rat 6478772 Anxrr49 Anxiety related response QTL 49 0.15488 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 631646 Stl4 Serum triglyceride level QTL 4 6.5 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 4 73169846 132642728 Rat 634334 Xhs3 X-ray hypersensitivity QTL 3 10 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 84728680 129854654 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 634344 Hcar7 Hepatocarcinoma resistance QTL 7 7.8 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 4 70808386 115808386 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 631662 Hcar2 Hepatocarcinoma resistance QTL 2 3.1 0.0003 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 78878504 123878504 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 61418 Pia5 Pristane induced arthritis QTL 5 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 62277855 128289560 Rat 631651 Bp124 Blood pressure QTL 124 3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 62879517 107879517 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2306899 Bp338 Blood pressure QTL 338 0.071 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 81006124 120102625 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 6478743 Anxrr40 Anxiety related response QTL 40 0.83076 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 12798520 Anxrr55 Anxiety related response QTL 55 4.45 0.01 locomotor behavior trait (VT:0001392) number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715) 4 32583980 114627242 Rat
RH130860
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 104,373,961 - 104,374,167 (+) MAPPER mRatBN7.2 Rnor_6.0 4 100,181,462 - 100,181,667 NCBI Rnor6.0 Rnor_5.0 4 164,952,223 - 164,952,428 UniSTS Rnor5.0 RGSC_v3.4 4 105,623,976 - 105,624,181 UniSTS RGSC3.4 Celera 4 93,528,010 - 93,528,215 UniSTS RH 3.4 Map 4 632.15 UniSTS Cytogenetic Map 4 q33 UniSTS
D6Wsu157e
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 104,373,956 - 104,374,117 (+) MAPPER mRatBN7.2 Rnor_6.0 4 100,181,457 - 100,181,617 NCBI Rnor6.0 Rnor_5.0 4 164,952,218 - 164,952,378 UniSTS Rnor5.0 RGSC_v3.4 4 105,623,971 - 105,624,131 UniSTS RGSC3.4 Celera 4 93,528,005 - 93,528,165 UniSTS Cytogenetic Map 4 q33 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000015562 ⟹ ENSRNOP00000015563
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,373,955 - 104,406,359 (-) Ensembl Rnor_6.0 Ensembl 4 100,181,455 - 100,213,858 (-) Ensembl
RefSeq Acc Id:
NM_001106597 ⟹ NP_001100067
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 105,932,140 - 105,964,551 (-) NCBI mRatBN7.2 4 104,373,948 - 104,406,359 (-) NCBI Rnor_6.0 4 100,181,408 - 100,207,761 (-) NCBI Rnor_5.0 4 164,952,169 - 164,982,100 (-) NCBI RGSC_v3.4 4 105,623,922 - 105,650,275 (-) RGD Celera 4 93,527,956 - 93,554,280 (-) RGD
Sequence:
GGCGCGGAAGCTCCTAACCGGTGGTGGCGATGTCTAGCCGGTCCAAGCGGCAGTCTCATGGTTCTACCCGTGGGAAGCGCGAGTCCGAGTCTCGAGGTAGCTCGGGTCGCATCAAGAAGGAGCGAGAC
hide sequence
RefSeq Acc Id:
NM_001398741 ⟹ NP_001385670
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 105,932,140 - 105,964,551 (-) NCBI mRatBN7.2 4 104,373,948 - 104,406,359 (-) NCBI
RefSeq Acc Id:
XM_063285778 ⟹ XP_063141848
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 105,932,144 - 105,962,047 (-) NCBI
RefSeq Acc Id:
NP_001100067 ⟸ NM_001106597
- Peptide Label:
isoform 1
- UniProtKB:
A6IAA2 (UniProtKB/TrEMBL)
- Sequence:
MSSRSKRQSHGSTRGKRESESRGSSGRIKKERDREKEPEAASSRGSPVRVKREAEPTPREVPAPVLPVVRVKREREADEDSEPEREVRAKNGRVDSEDRRSRHCPYLDTINRSVLDFDFEKLCSISLS
hide sequence
Ensembl Acc Id:
ENSRNOP00000015563 ⟸ ENSRNOT00000015562
RefSeq Acc Id:
NP_001385670 ⟸ NM_001398741
- Peptide Label:
isoform 2
- UniProtKB:
F7F1N8 (UniProtKB/TrEMBL), B2GV41 (UniProtKB/TrEMBL), A0A9K3Y7X0 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141848 ⟸ XM_063285778
- Peptide Label:
isoform X1
- UniProtKB:
A0A9K3Y7X0 (UniProtKB/TrEMBL), B2GV41 (UniProtKB/TrEMBL), F7F1N8 (UniProtKB/TrEMBL)
RGD ID: 13693124 Promoter ID: EPDNEW_R3649 Type: initiation region Name: Usp39_1 Description: ubiquitin specific peptidase 39 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 100,207,746 - 100,207,806 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-04
Usp39
ubiquitin specific peptidase 39
Usp39_predicted
ubiquitin specific protease 39 (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-12
Usp39_predicted
ubiquitin specific protease 39 (predicted)
Symbol and Name status set to approved
70820 APPROVED
