Symbol:
Pak4
Name:
p21 (RAC1) activated kinase 4
RGD ID:
1307705
Description:
Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in several processes, including negative regulation of endothelial cell apoptotic process; positive regulation of angiogenesis; and regulation of MAPK cascade. Predicted to act upstream of or within dendritic spine development. Predicted to be active in cytoplasm. Orthologous to human PAK4 (p21 (RAC1) activated kinase 4); PARTICIPATES IN fibroblast growth factor signaling pathway; epidermal growth factor/neuregulin signaling pathway; renal cell carcinoma pathway; INTERACTS WITH 2,4-dinitrotoluene; 6-propyl-2-thiouracil; atrazine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC292756; p21 (CDKN1A)-activated kinase 4; p21 protein (Cdc42/Rac)-activated kinase 4; p21-activated kinase 4; serine/threonine-protein kinase PAK 4
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PAK4 (p21 (RAC1) activated kinase 4) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Pak4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pak4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PAK4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PAK4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pak4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PAK4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PAK4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pak4 (p21 (RAC1) activated kinase 4) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
PAK4 (p21 (RAC1) activated kinase 4)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Pak4 (p21 (RAC1) activated kinase 4)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pak4 (p21 protein (Cdc42/Rac)-activated kinase 4)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|PANTHER|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
CLA4
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER)
Drosophila melanogaster (fruit fly):
mbt
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
pak-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SKM1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
pak4
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 92,977,437 - 93,016,721 (-) NCBI GRCr8 mRatBN7.2 1 83,849,904 - 83,889,188 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 83,849,904 - 83,859,413 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 89,259,841 - 89,299,237 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 97,718,978 - 97,758,274 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 91,015,714 - 91,055,110 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 85,162,462 - 85,201,746 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 85,162,452 - 85,201,757 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 86,378,296 - 86,417,580 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 83,670,786 - 83,710,070 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 83,749,728 - 83,797,056 (-) NCBI Celera 1 78,244,198 - 78,283,501 (-) NCBI Celera Cytogenetic Map 1 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pak4 Rat 1,2-dimethylhydrazine multiple interactions ISO Pak4 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of PAK4 mRNA CTD PMID:22206623 Pak4 Rat 17alpha-ethynylestradiol affects expression ISO Pak4 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of PAK4 mRNA CTD PMID:17555576 Pak4 Rat 17alpha-ethynylestradiol multiple interactions ISO Pak4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PAK4 mRNA CTD PMID:17942748 Pak4 Rat 17alpha-ethynylestradiol increases expression ISO Pak4 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PAK4 mRNA CTD PMID:17942748 Pak4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Pak4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PAK4 mRNA CTD PMID:17942748 Pak4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO PAK4 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of PAK4 mRNA CTD PMID:23152189 Pak4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Pak4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of PAK4 mRNA CTD PMID:17942748 Pak4 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of PAK4 mRNA CTD PMID:21346803 Pak4 Rat 4,4'-diaminodiphenylmethane increases expression ISO Pak4 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in increased expression of PAK4 mRNA CTD PMID:18648102 Pak4 Rat 4,4'-sulfonyldiphenol decreases expression ISO Pak4 (Mus musculus) 6480464 bisphenol S results in decreased expression of PAK4 mRNA CTD PMID:39298647 Pak4 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of PAK4 mRNA CTD PMID:24780913 Pak4 Rat acrolein multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PAK4 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of PAK4 mRNA CTD PMID:32699268 Pak4 Rat Aflatoxin B2 alpha affects methylation ISO PAK4 (Homo sapiens) 6480464 aflatoxin B2 affects the methylation of PAK4 intron CTD PMID:30157460 Pak4 Rat alpha-pinene multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PAK4 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of PAK4 mRNA CTD PMID:32699268 Pak4 Rat aristolochic acid A increases expression ISO PAK4 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of PAK4 mRNA CTD PMID:33212167 Pak4 Rat arsane multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat arsenic atom multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of PAK4 gene CTD PMID:35440735 Pak4 Rat Azoxymethane multiple interactions ISO Pak4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PAK4 mRNA CTD PMID:29950665 Pak4 Rat benzo[a]pyrene increases expression ISO Pak4 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of PAK4 mRNA CTD PMID:22228805 Pak4 Rat benzo[a]pyrene decreases methylation ISO PAK4 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of PAK4 5' UTR CTD PMID:27901495 Pak4 Rat benzo[a]pyrene affects methylation ISO PAK4 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PAK4 intron CTD PMID:30157460 Pak4 Rat benzo[e]pyrene increases methylation ISO PAK4 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of PAK4 intron CTD PMID:30157460 Pak4 Rat bis(2-ethylhexyl) phthalate increases expression ISO Pak4 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of PAK4 mRNA CTD PMID:34319233 Pak4 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of PAK4 mRNA CTD PMID:25181051 Pak4 Rat cadmium atom multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of PAK4 mRNA CTD PMID:35301059 Pak4 Rat cadmium dichloride multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of PAK4 mRNA CTD PMID:35301059 Pak4 Rat caffeine increases phosphorylation ISO PAK4 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of PAK4 protein CTD PMID:35688186 Pak4 Rat captan increases expression ISO Pak4 (Mus musculus) 6480464 Captan results in increased expression of PAK4 mRNA CTD PMID:31558096 Pak4 Rat carbon nanotube decreases expression ISO Pak4 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Pak4 Rat choline multiple interactions ISO Pak4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of PAK4 gene CTD PMID:20938992 Pak4 Rat coumarin decreases phosphorylation ISO PAK4 (Homo sapiens) 6480464 coumarin results in decreased phosphorylation of PAK4 protein CTD PMID:35688186 Pak4 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of PAK4 mRNA CTD PMID:26577399 Pak4 Rat dextran sulfate multiple interactions ISO Pak4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PAK4 mRNA CTD PMID:29950665 Pak4 Rat dicrotophos increases expression ISO PAK4 (Homo sapiens) 6480464 dicrotophos results in increased expression of PAK4 mRNA CTD PMID:28302478 Pak4 Rat elemental selenium increases expression ISO PAK4 (Homo sapiens) 6480464 Selenium results in increased expression of PAK4 mRNA CTD PMID:19244175 Pak4 Rat fenthion decreases expression ISO Pak4 (Mus musculus) 6480464 Fenthion results in decreased expression of PAK4 mRNA CTD PMID:34813904 Pak4 Rat folic acid multiple interactions ISO Pak4 (Mus musculus) 6480464 [1 more ... CTD PMID:20938992 and PMID:22206623 Pak4 Rat folic acid increases expression ISO Pak4 (Mus musculus) 6480464 Folic Acid results in increased expression of PAK4 mRNA CTD PMID:25629700 Pak4 Rat folpet increases expression ISO Pak4 (Mus musculus) 6480464 folpet results in increased expression of PAK4 mRNA CTD PMID:31558096 Pak4 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of PAK4 mRNA CTD PMID:33387578 Pak4 Rat ivermectin decreases expression ISO PAK4 (Homo sapiens) 6480464 Ivermectin results in decreased expression of PAK4 protein CTD PMID:32959892 Pak4 Rat L-methionine multiple interactions ISO Pak4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of PAK4 gene CTD PMID:20938992 Pak4 Rat lead diacetate increases expression ISO PAK4 (Homo sapiens) 6480464 lead acetate results in increased expression of PAK4 mRNA CTD PMID:38568856 Pak4 Rat manganese atom multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat manganese(0) multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat manganese(II) chloride multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat methapyrilene increases methylation ISO PAK4 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of PAK4 intron CTD PMID:30157460 Pak4 Rat methidathion decreases expression ISO Pak4 (Mus musculus) 6480464 methidathion results in decreased expression of PAK4 mRNA CTD PMID:34813904 Pak4 Rat methoxyacetic acid affects expression EXP 6480464 methoxyacetic acid affects the expression of PAK4 mRNA CTD PMID:20864626 Pak4 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of PAK4 gene CTD PMID:35440735 Pak4 Rat N-ethyl-N-nitrosourea increases mutagenesis ISO Pak4 (Mus musculus) 6480464 Ethylnitrosourea results in increased mutagenesis of PAK4 exon CTD PMID:16300676 Pak4 Rat ozone multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of PAK4 mRNA more ... CTD PMID:32699268 Pak4 Rat paracetamol affects expression ISO Pak4 (Mus musculus) 6480464 Acetaminophen affects the expression of PAK4 mRNA CTD PMID:17562736 Pak4 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of PAK4 mRNA CTD PMID:33387578 Pak4 Rat paracetamol decreases expression ISO PAK4 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of PAK4 mRNA CTD PMID:26690555 Pak4 Rat PF-3758309 decreases expression ISO PAK4 (Homo sapiens) 6480464 PF 3758309 results in decreased expression of PAK4 protein CTD PMID:29048629 Pak4 Rat PF-3758309 increases response to substance ISO PAK4 (Homo sapiens) 6480464 PAK4 protein results in increased susceptibility to PF 3758309 CTD PMID:29048629 Pak4 Rat resveratrol multiple interactions ISO PAK4 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of PAK4 mRNA CTD PMID:23557933 Pak4 Rat rotenone decreases expression ISO PAK4 (Homo sapiens) 6480464 Rotenone results in decreased expression of PAK4 mRNA CTD PMID:33512557 Pak4 Rat SB 431542 increases expression ISO PAK4 (Homo sapiens) 6480464 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide results in increased expression of PAK4 protein CTD PMID:25670856 Pak4 Rat selenium atom increases expression ISO PAK4 (Homo sapiens) 6480464 Selenium results in increased expression of PAK4 mRNA CTD PMID:19244175 Pak4 Rat sodium arsenite increases expression ISO PAK4 (Homo sapiens) 6480464 sodium arsenite results in increased expression of PAK4 mRNA CTD PMID:38568856 Pak4 Rat sodium arsenite multiple interactions ISO PAK4 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of PAK4 mRNA CTD PMID:39836092 Pak4 Rat sodium dichromate increases expression ISO Pak4 (Mus musculus) 6480464 sodium bichromate results in increased expression of PAK4 mRNA CTD PMID:31558096 Pak4 Rat sunitinib decreases expression ISO PAK4 (Homo sapiens) 6480464 Sunitinib results in decreased expression of PAK4 mRNA CTD PMID:31533062 Pak4 Rat tamoxifen affects expression ISO Pak4 (Mus musculus) 6480464 Tamoxifen affects the expression of PAK4 mRNA CTD PMID:17555576 Pak4 Rat taurine decreases expression ISO PAK4 (Homo sapiens) 6480464 Taurine results in decreased expression of PAK4 mRNA CTD PMID:16579726 Pak4 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of PAK4 mRNA CTD PMID:34492290 Pak4 Rat titanium dioxide multiple interactions ISO Pak4 (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PAK4 mRNA CTD PMID:29950665 Pak4 Rat titanium dioxide decreases methylation ISO Pak4 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of PAK4 gene CTD PMID:35295148 Pak4 Rat titanium dioxide increases methylation ISO Pak4 (Mus musculus) 6480464 titanium dioxide results in increased methylation of PAK4 promoter CTD PMID:35295148 Pak4 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of PAK4 mRNA CTD PMID:19015723
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
Pak4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 92,977,437 - 93,016,721 (-) NCBI GRCr8 mRatBN7.2 1 83,849,904 - 83,889,188 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 83,849,904 - 83,859,413 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 89,259,841 - 89,299,237 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 97,718,978 - 97,758,274 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 91,015,714 - 91,055,110 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 85,162,462 - 85,201,746 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 85,162,452 - 85,201,757 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 86,378,296 - 86,417,580 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 83,670,786 - 83,710,070 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 83,749,728 - 83,797,056 (-) NCBI Celera 1 78,244,198 - 78,283,501 (-) NCBI Celera Cytogenetic Map 1 q21 NCBI
PAK4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 39,125,786 - 39,182,816 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 39,125,770 - 39,182,816 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 39,616,426 - 39,673,456 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 44,308,260 - 44,361,886 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 19 44,308,301 - 44,361,882 NCBI Celera 19 36,418,829 - 36,473,610 (+) NCBI Celera Cytogenetic Map 19 q13.2 NCBI HuRef 19 36,063,360 - 36,116,946 (+) NCBI HuRef CHM1_1 19 39,617,306 - 39,670,871 (+) NCBI CHM1_1 T2T-CHM13v2.0 19 41,929,765 - 41,986,971 (+) NCBI T2T-CHM13v2.0
Pak4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 28,258,244 - 28,297,609 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 28,258,244 - 28,297,610 (-) Ensembl GRCm39 Ensembl GRCm38 7 28,558,819 - 28,598,184 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 28,558,819 - 28,598,185 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 29,343,838 - 29,383,203 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 28,267,579 - 28,306,906 (-) NCBI MGSCv36 mm8 Celera 7 23,123,936 - 23,163,272 (-) NCBI Celera Cytogenetic Map 7 A3- B1 NCBI cM Map 7 16.84 NCBI
Pak4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955468 367,971 - 378,271 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955468 368,721 - 417,614 (-) NCBI ChiLan1.0 ChiLan1.0
PAK4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 45,421,628 - 45,475,524 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 47,292,159 - 47,346,128 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 19 36,224,442 - 36,278,371 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 19 44,773,098 - 44,826,651 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 19 44,816,601 - 44,825,827 (+) Ensembl panpan1.1 panPan2
PAK4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 114,009,573 - 114,052,100 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 114,009,711 - 114,018,191 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 113,410,153 - 113,453,319 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 114,608,125 - 114,651,302 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 114,608,128 - 114,651,260 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 114,166,259 - 114,201,907 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 113,799,180 - 113,842,525 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 114,794,554 - 114,837,946 (-) NCBI UU_Cfam_GSD_1.0
Pak4
PAK4 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 47,869,577 - 47,914,182 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 47,869,604 - 47,914,185 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 43,357,961 - 43,402,756 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PAK4 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 33,715,695 - 33,769,272 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 33,759,462 - 33,770,497 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666073 11,743,338 - 11,796,584 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pak4
.
Predicted Target Of
Count of predictions: 104 Count of miRNA genes: 82 Interacting mature miRNAs: 95 Transcripts: ENSRNOT00000026966 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2313059 Bss55 Bone structure and strength QTL 55 3.2 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1578649 Bmd8 Bone mineral density QTL 8 4.9 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 1 49393172 94393172 Rat 1582234 Gluco18 Glucose level QTL 18 3.4 0.0003 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 78479925 123479925 Rat 1358359 Sradr1 Stress Responsive Adrenal Weight QTL 1 4.74 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 30882023 123479925 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1554320 Bmd1 Bone mineral density QTL 1 12.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 509108 86060548 Rat 2302059 Pia36 Pristane induced arthritis QTL 36 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 43333002 88333002 Rat 1300121 Hrtrt1 Heart rate QTL 1 3.7 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 65789093 115540829 Rat 7421628 Bp361 Blood pressure QTL 361 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 66023617 118608521 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 631512 Scl6 Serum cholesterol level QTL 6 9.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 1 72197680 90508767 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 2313072 Bss53 Bone structure and strength QTL 53 4.3 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 43284731 118944897 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 2313078 Bss54 Bone structure and strength QTL 54 3.5 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 1549903 Bp267 Blood pressure QTL 267 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 77876254 106047988 Rat 2313083 Bmd74 Bone mineral density QTL 74 4 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 82174743 118944897 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 4889494 Scort2 Serum corticosterone level QTL 2 4.2 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 80592172 125592172 Rat 61342 Bp27 Blood pressure QTL 27 3.4 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 56732668 98773277 Rat 1300172 Bp172 Blood pressure QTL 172 3.56 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 32737273 90665040 Rat 61344 Bp29 Blood pressure QTL 29 7.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 78350581 123350581 Rat 1358192 Ept13 Estrogen-induced pituitary tumorigenesis QTL 13 3.4 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 77494165 122494165 Rat 2313094 Bss58 Bone structure and strength QTL 58 3.7 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 43284731 118944897 Rat 6903308 Scl36 Serum cholesterol QTL 36 2 0.0125 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 53863041 90532583 Rat 2300164 Bmd44 Bone mineral density QTL 44 5.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 1 56949932 101949932 Rat 2313099 Bss56 Bone structure and strength QTL 56 2.4 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 1 43284731 118944897 Rat 2313098 Bmd70 Bone mineral density QTL 70 3.6 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 43284731 118944897 Rat 738022 Anxrr13 Anxiety related response QTL 13 4.6 0.00039 locomotor behavior trait (VT:0001392) number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514) 1 83547917 128547917 Rat 152025249 Scl82 Serum cholesterol level QTL 82 4.77 blood cholesterol amount (VT:0000180) 1 50343510 99980958 Rat 10054135 Gmadr2 Adrenal mass QTL 2 1.97 0.0129 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 77857876 122857876 Rat 7411712 Strs4 Sensitivity to stroke QTL 4 8.7 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 1 78430536 123430536 Rat 2313051 Bss57 Bone structure and strength QTL 57 3.7 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 43284731 118944897 Rat 61433 Cia2 Collagen induced arthritis QTL 2 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 78430754 91209302 Rat
AI030619
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 83,849,992 - 83,850,147 (-) MAPPER mRatBN7.2 Rnor_6.0 1 85,201,503 - 85,201,657 NCBI Rnor6.0 Rnor_5.0 1 86,417,337 - 86,417,491 UniSTS Rnor5.0 RGSC_v3.4 1 83,670,875 - 83,671,029 UniSTS RGSC3.4 Celera 1 78,244,287 - 78,244,441 UniSTS RH 3.4 Map 1 829.8 UniSTS Cytogenetic Map 1 q21 UniSTS
MARC_20651-20652:1024691026:1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 83,853,732 - 83,855,093 (-) MAPPER mRatBN7.2 Rnor_6.0 1 85,196,557 - 85,197,917 NCBI Rnor6.0 Rnor_5.0 1 86,412,391 - 86,413,751 UniSTS Rnor5.0 RGSC_v3.4 1 83,674,615 - 83,675,975 UniSTS RGSC3.4 Celera 1 78,248,027 - 78,249,387 UniSTS Cytogenetic Map 1 q21 UniSTS
Pak4
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 83,850,001 - 83,850,869 (-) MAPPER mRatBN7.2 Rnor_6.0 1 85,200,781 - 85,201,648 NCBI Rnor6.0 Rnor_5.0 1 86,416,615 - 86,417,482 UniSTS Rnor5.0 RGSC_v3.4 1 83,670,884 - 83,671,751 UniSTS RGSC3.4 Celera 1 78,244,296 - 78,245,163 UniSTS Cytogenetic Map 1 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026966 ⟹ ENSRNOP00000026966
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 83,849,904 - 83,859,413 (-) Ensembl Rnor_6.0 Ensembl 1 85,192,174 - 85,201,757 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000093158
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 1 85,199,715 - 85,200,344 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000093347 ⟹ ENSRNOP00000076081
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 1 85,162,452 - 85,201,718 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000093747
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 1 85,196,687 - 85,197,315 (+) Ensembl
RefSeq Acc Id:
NM_001106238 ⟹ NP_001099708
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 92,977,437 - 93,016,721 (-) NCBI mRatBN7.2 1 83,849,904 - 83,889,188 (-) NCBI Rnor_6.0 1 85,162,462 - 85,201,746 (+) NCBI Rnor_5.0 1 86,378,296 - 86,417,580 (+) NCBI RGSC_v3.4 1 83,670,786 - 83,710,070 (-) RGD Celera 1 78,244,198 - 78,283,501 (-) RGD
Sequence:
GCGGCGGCAGTAGCCGCGGCGGCGGCGGCTCGAGACAGCTGAGGGCGGTACGCGGGCGCAGAGTTCTGGGCCCGGCAGCTAGGCCGCGAGCGACCGCGGCGCCAAGCCGATGAGTAACTCAAAGCCTC
hide sequence
RefSeq Acc Id:
XM_063283327 ⟹ XP_063139397
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 92,977,465 - 92,995,436 (-) NCBI
RefSeq Acc Id:
NP_001099708 ⟸ NM_001106238
- UniProtKB:
B5DF62 (UniProtKB/TrEMBL), F7FL63 (UniProtKB/TrEMBL)
- Sequence:
MFGKKKKRVEISAPSNFEHRVHTGFDQHEQKFTGLPRQWQSLIEESARRPKPLIDPACITSIQPGAPKTIVRGSKGAKDGALTLLLDEFENMSVTRSNSLRRESPPPPARAHQENGMLEERAALARMA
hide sequence
Ensembl Acc Id:
ENSRNOP00000026966 ⟸ ENSRNOT00000026966
Ensembl Acc Id:
ENSRNOP00000076081 ⟸ ENSRNOT00000093347
RefSeq Acc Id:
XP_063139397 ⟸ XM_063283327
- Peptide Label:
isoform X1
- UniProtKB:
B5DF62 (UniProtKB/TrEMBL), F7FL63 (UniProtKB/TrEMBL)
RGD ID: 13689865 Promoter ID: EPDNEW_R390 Type: multiple initiation site Name: Pak4_1 Description: p21 activated kinase 4 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 85,162,448 - 85,162,508 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-05-12
Pak4
p21 (RAC1) activated kinase 4
Pak4
p21 protein (Cdc42/Rac)-activated kinase 4
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2009-05-27
Pak4
p21 protein (Cdc42/Rac)-activated kinase 4
Pak4
p21 (CDKN1A)-activated kinase 4
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Pak4
p21 (CDKN1A)-activated kinase 4
Pak4_predicted
p21 (CDKN1A)-activated kinase 4 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Pak4_predicted
p21 (CDKN1A)-activated kinase 4 (predicted)
Symbol and Name status set to approved
70820 APPROVED
