Symbol:
Usp7
Name:
ubiquitin specific peptidase 7
RGD ID:
1306915
Description:
Enables cysteine-type deubiquitinase activity and identical protein binding activity. Involved in positive regulation of apoptotic process; protein deubiquitination; and regulation of protein stability. Predicted to be located in XY body and cytoplasm. Predicted to be part of protein-containing complex. Predicted to be active in PML body and cytosol. Orthologous to human USP7 (ubiquitin specific peptidase 7); PARTICIPATES IN p53 signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
deubiquitinating enzyme 7; Hausp; herpes-virus-associated ubiquitin-specific protease; herpesvirus-associated ubiquitin-specific protease; LOC360471; rHAUSP; ubiquitin carboxyl-terminal hydrolase 7; ubiquitin specific peptidase 7 (herpes virus-associated); ubiquitin specific protease 7 (herpes virus-associated); ubiquitin thioesterase 7; ubiquitin-specific-processing protease 7
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 7,335,508 - 7,432,018 (+) NCBI GRCr8 mRatBN7.2 10 6,880,684 - 6,925,355 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 6,828,795 - 6,925,355 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 11,588,325 - 11,631,578 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 11,084,682 - 11,128,048 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 6,735,783 - 6,779,154 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 6,930,462 - 7,019,910 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 6,975,244 - 7,018,930 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 5,752,834 - 5,822,229 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 6,917,612 - 6,963,452 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 6,917,611 - 6,963,451 (+) NCBI Celera 10 5,876,459 - 5,919,649 (+) NCBI Celera Cytogenetic Map 10 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Usp7 Rat 1,2-dimethylhydrazine decreases expression ISO Usp7 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of USP7 mRNA CTD PMID:22206623 Usp7 Rat 1,2-dimethylhydrazine multiple interactions ISO Usp7 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of USP7 mRNA CTD PMID:22206623 Usp7 Rat 17alpha-ethynylestradiol multiple interactions ISO Usp7 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of USP7 mRNA CTD PMID:17942748 Usp7 Rat 17alpha-ethynylestradiol increases expression ISO Usp7 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of USP7 mRNA CTD PMID:17942748 Usp7 Rat 17beta-estradiol increases expression ISO USP7 (Homo sapiens) 6480464 Estradiol results in increased expression of USP7 mRNA CTD PMID:23019147 Usp7 Rat 17beta-estradiol increases expression ISO Usp7 (Mus musculus) 6480464 Estradiol results in increased expression of USP7 mRNA CTD PMID:39298647 Usp7 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Usp7 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of USP7 mRNA CTD PMID:17942748 Usp7 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of USP7 mRNA CTD PMID:33387578 Usp7 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Usp7 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of USP7 mRNA CTD PMID:21570461 and PMID:24680724 Usp7 Rat 2,4,6-tribromophenol decreases expression ISO USP7 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Usp7 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of USP7 mRNA CTD PMID:21346803 Usp7 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of USP7 mRNA CTD PMID:21346803 Usp7 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression EXP 6480464 tetrabromobisphenol A results in decreased expression of USP7 mRNA CTD PMID:27914987 Usp7 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO USP7 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of USP7 protein CTD PMID:31675489 Usp7 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Usp7 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of USP7 mRNA CTD PMID:26251327 Usp7 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO USP7 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of USP7 mRNA CTD PMID:28628672 Usp7 Rat 4,4'-sulfonyldiphenol multiple interactions ISO USP7 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of USP7 mRNA CTD PMID:28628672 Usp7 Rat 4-amino-2,6-dinitrotoluene affects expression EXP 6480464 4-amino-2 and 6-dinitrotoluene affects the expression of USP7 mRNA CTD PMID:21346803 Usp7 Rat 4-hydroxyphenyl retinamide increases expression ISO Usp7 (Mus musculus) 6480464 Fenretinide results in increased expression of USP7 mRNA CTD PMID:28973697 Usp7 Rat 4-nitrophenol decreases expression ISO Usp7 (Mus musculus) 6480464 4-nitrophenol results in decreased expression of USP7 mRNA CTD PMID:34673133 Usp7 Rat 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide multiple interactions ISO Usp7 (Mus musculus) 6480464 6-chloro-2 more ... CTD PMID:25665036 Usp7 Rat ABT-737 multiple interactions ISO USP7 (Homo sapiens) 6480464 USP7 protein affects the reaction [[[ABT-737 co-treated with Benzo(a)pyrene] co-treated with [sodium arsenite results in increased abundance of Arsenic]] results in decreased cleavage of CASP3 protein] and USP7 protein affects the reaction [[[ABT-737 co-treated with Benzo(a)pyrene] co-treated with [sodium arsenite results in increased abundance of Arsenic]] results in decreased cleavage of PARP1 protein] CTD PMID:32802178 Usp7 Rat aflatoxin B1 increases expression ISO Usp7 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of USP7 mRNA CTD PMID:19770486 Usp7 Rat aflatoxin B1 increases methylation ISO USP7 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of USP7 intron CTD PMID:30157460 Usp7 Rat aflatoxin B1 decreases expression ISO USP7 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of USP7 mRNA CTD PMID:21641981 Usp7 Rat antirheumatic drug increases expression ISO USP7 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of USP7 mRNA CTD PMID:24449571 Usp7 Rat aristolochic acid A decreases expression ISO USP7 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of USP7 mRNA CTD PMID:33212167 Usp7 Rat arsane affects methylation ISO USP7 (Homo sapiens) 6480464 Arsenic affects the methylation of USP7 gene CTD PMID:25304211 Usp7 Rat arsane decreases activity ISO USP7 (Homo sapiens) 6480464 Arsenic results in decreased activity of USP7 protein CTD PMID:35821281 Usp7 Rat arsane increases ubiquitination ISO USP7 (Homo sapiens) 6480464 Arsenic results in increased ubiquitination of USP7 protein CTD PMID:35821281 Usp7 Rat arsane multiple interactions ISO USP7 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein more ... CTD PMID:32802178 and PMID:35821281 Usp7 Rat arsenic atom affects methylation ISO USP7 (Homo sapiens) 6480464 Arsenic affects the methylation of USP7 gene CTD PMID:25304211 Usp7 Rat arsenic atom decreases activity ISO USP7 (Homo sapiens) 6480464 Arsenic results in decreased activity of USP7 protein CTD PMID:35821281 Usp7 Rat arsenic atom increases ubiquitination ISO USP7 (Homo sapiens) 6480464 Arsenic results in increased ubiquitination of USP7 protein CTD PMID:35821281 Usp7 Rat arsenic atom multiple interactions ISO USP7 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein more ... CTD PMID:32802178 and PMID:35821281 Usp7 Rat arsenite(3-) multiple interactions ISO USP7 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to USP7 mRNA] CTD PMID:32406909 Usp7 Rat arsenous acid increases expression ISO USP7 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of USP7 mRNA CTD PMID:34108876 Usp7 Rat azoxystrobin decreases expression ISO USP7 (Homo sapiens) 6480464 azoxystrobin results in decreased expression of USP7 mRNA CTD PMID:33512557 Usp7 Rat benzo[a]pyrene decreases methylation ISO Usp7 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased methylation of USP7 3' UTR more ... CTD PMID:27901495 Usp7 Rat benzo[a]pyrene multiple interactions ISO USP7 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein more ... CTD PMID:32802178 Usp7 Rat benzo[a]pyrene diol epoxide I decreases expression ISO USP7 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Usp7 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Usp7 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of USP7 mRNA CTD PMID:33754040 Usp7 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in increased methylation of USP7 gene CTD PMID:28505145 Usp7 Rat bisphenol A decreases expression ISO USP7 (Homo sapiens) 6480464 bisphenol A results in decreased expression of USP7 protein CTD PMID:37567409 Usp7 Rat bisphenol A decreases expression ISO Usp7 (Mus musculus) 6480464 bisphenol A results in decreased expression of USP7 mRNA CTD PMID:33221593 Usp7 Rat bisphenol A decreases methylation ISO USP7 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of USP7 gene CTD PMID:31601247 Usp7 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of USP7 mRNA CTD PMID:34947998 Usp7 Rat Bisphenol B increases expression ISO USP7 (Homo sapiens) 6480464 bisphenol B results in increased expression of USP7 protein CTD PMID:34186270 Usp7 Rat bisphenol F increases expression ISO USP7 (Homo sapiens) 6480464 bisphenol F results in increased expression of USP7 protein CTD PMID:34186270 Usp7 Rat butanal decreases expression ISO USP7 (Homo sapiens) 6480464 butyraldehyde results in decreased expression of USP7 mRNA CTD PMID:26079696 Usp7 Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of USP7 mRNA CTD PMID:33453195 Usp7 Rat caffeine affects phosphorylation ISO USP7 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of USP7 protein CTD PMID:35688186 Usp7 Rat carbon nanotube decreases expression ISO Usp7 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Usp7 Rat carbonyl sulfide increases expression EXP 6480464 carbonyl sulfide results in increased expression of USP7 mRNA CTD PMID:19395590 Usp7 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of USP7 mRNA CTD PMID:23125180 Usp7 Rat chloroquine multiple interactions ISO Usp7 (Mus musculus) 6480464 Chloroquine inhibits the reaction [lipopolysaccharide more ... CTD PMID:28134560 Usp7 Rat chloroquine increases expression ISO Usp7 (Mus musculus) 6480464 Chloroquine results in increased expression of USP7 mRNA CTD PMID:28134560 Usp7 Rat chlorpyrifos increases expression ISO Usp7 (Mus musculus) 6480464 Chlorpyrifos results in increased expression of USP7 mRNA CTD PMID:20350560 Usp7 Rat chlorpyrifos decreases expression ISO Usp7 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of USP7 mRNA CTD PMID:37019170 Usp7 Rat cisplatin decreases expression ISO USP7 (Homo sapiens) 6480464 Cisplatin results in decreased expression of USP7 mRNA CTD PMID:27594783 Usp7 Rat clofibrate decreases expression ISO Usp7 (Mus musculus) 6480464 Clofibrate results in decreased expression of USP7 mRNA CTD PMID:17585979 Usp7 Rat cocaine increases expression EXP 6480464 Cocaine results in increased expression of USP7 mRNA CTD PMID:17898221 Usp7 Rat Cuprizon multiple interactions ISO USP7 (Homo sapiens) 6480464 [Cuprizone co-treated with Haloperidol] results in increased expression of USP7 protein CTD PMID:34122009 Usp7 Rat cycloheximide multiple interactions ISO USP7 (Homo sapiens) 6480464 USP7 protein inhibits the reaction [Cycloheximide results in decreased expression of HMOX1 protein] and USP7 protein mutant form affects the reaction [Cycloheximide results in decreased expression of HMOX1 protein] CTD PMID:35821281 Usp7 Rat cytarabine decreases expression ISO USP7 (Homo sapiens) 6480464 Cytarabine results in decreased expression of USP7 mRNA CTD PMID:19194470 Usp7 Rat dexamethasone multiple interactions ISO USP7 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of USP7 mRNA CTD PMID:28628672 Usp7 Rat diarsenic trioxide increases expression ISO USP7 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of USP7 mRNA CTD PMID:34108876 Usp7 Rat dibutyl phthalate decreases expression ISO Usp7 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of USP7 mRNA CTD PMID:21266533 Usp7 Rat dimethylarsinic acid increases expression ISO USP7 (Homo sapiens) 6480464 Cacodylic Acid results in increased expression of USP7 mRNA CTD PMID:17720352 Usp7 Rat doxorubicin multiple interactions ISO Usp7 (Mus musculus) 6480464 6-chloro-2 more ... CTD PMID:25665036 Usp7 Rat doxorubicin increases expression ISO USP7 (Homo sapiens) 6480464 Doxorubicin results in increased expression of USP7 mRNA CTD PMID:29803840 Usp7 Rat doxorubicin increases oxidation EXP 6480464 Doxorubicin results in increased oxidation of USP7 protein CTD PMID:28818578 Usp7 Rat doxorubicin increases expression ISO Usp7 (Mus musculus) 6480464 Doxorubicin results in increased expression of USP7 protein CTD PMID:25665036 Usp7 Rat enzyme inhibitor multiple interactions ISO USP7 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of USP7 protein CTD PMID:23301498 Usp7 Rat ethanol affects splicing ISO Usp7 (Mus musculus) 6480464 Ethanol affects the splicing of USP7 mRNA CTD PMID:30319688 Usp7 Rat ethyl methanesulfonate decreases expression ISO USP7 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of USP7 mRNA CTD PMID:23649840 Usp7 Rat fenofibrate increases expression ISO Usp7 (Mus musculus) 6480464 Fenofibrate results in increased expression of USP7 mRNA CTD PMID:21318169 Usp7 Rat fenofibrate multiple interactions ISO Usp7 (Mus musculus) 6480464 PPARA protein affects the reaction [Fenofibrate results in increased expression of USP7 mRNA] CTD PMID:21318169 Usp7 Rat fenthion increases expression ISO Usp7 (Mus musculus) 6480464 Fenthion results in increased expression of USP7 mRNA CTD PMID:34813904 Usp7 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of USP7 mRNA CTD PMID:21525395 Usp7 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of USP7 mRNA CTD PMID:24136188 Usp7 Rat folic acid multiple interactions ISO Usp7 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of USP7 mRNA CTD PMID:22206623 Usp7 Rat formaldehyde decreases expression ISO USP7 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of USP7 mRNA CTD PMID:23649840 Usp7 Rat FR900359 increases phosphorylation ISO USP7 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of USP7 protein CTD PMID:37730182 Usp7 Rat fulvestrant increases methylation ISO USP7 (Homo sapiens) 6480464 Fulvestrant results in increased methylation of USP7 gene CTD PMID:31601247 Usp7 Rat genistein multiple interactions EXP 6480464 [bisphenol A co-treated with Genistein] results in increased methylation of USP7 gene CTD PMID:28505145 Usp7 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of USP7 mRNA CTD PMID:22061828 Usp7 Rat haloperidol multiple interactions ISO USP7 (Homo sapiens) 6480464 [Cuprizone co-treated with Haloperidol] results in increased expression of USP7 protein CTD PMID:34122009 Usp7 Rat hydrogen peroxide affects expression ISO USP7 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of USP7 mRNA CTD PMID:20044591 Usp7 Rat indometacin multiple interactions ISO USP7 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of USP7 mRNA CTD PMID:28628672 Usp7 Rat ivermectin decreases expression ISO USP7 (Homo sapiens) 6480464 Ivermectin results in decreased expression of USP7 protein CTD PMID:32959892 Usp7 Rat menadione affects expression ISO USP7 (Homo sapiens) 6480464 Vitamin K 3 affects the expression of USP7 mRNA CTD PMID:20044591 Usp7 Rat methidathion increases expression ISO Usp7 (Mus musculus) 6480464 methidathion results in increased expression of USP7 mRNA CTD PMID:34813904 Usp7 Rat methylmercury chloride decreases expression ISO USP7 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of USP7 mRNA CTD PMID:28001369 Usp7 Rat microcystin-LR decreases expression ISO Usp7 (Mus musculus) 6480464 cyanoginosin LR results in decreased expression of USP7 protein CTD PMID:26984711 Usp7 Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal multiple interactions ISO USP7 (Homo sapiens) 6480464 [USP7 protein co-treated with benzyloxycarbonylleucyl-leucyl-leucine aldehyde] results in increased ubiquitination of HMOX1 protein more ... CTD PMID:32802178 and PMID:35821281 Usp7 Rat nefazodone increases expression EXP 6480464 nefazodone results in increased expression of USP7 mRNA CTD PMID:24136188 Usp7 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of USP7 mRNA CTD PMID:25729387 Usp7 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of USP7 mRNA CTD PMID:33387578 Usp7 Rat paraquat decreases expression ISO Usp7 (Mus musculus) 6480464 Paraquat results in decreased expression of USP7 mRNA CTD PMID:21371552 Usp7 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Usp7 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of USP7 mRNA CTD PMID:36331819 Usp7 Rat phenethyl isothiocyanate decreases expression EXP 6480464 phenethyl isothiocyanate results in decreased expression of USP7 mRNA CTD PMID:17616710 Usp7 Rat phenobarbital affects expression ISO Usp7 (Mus musculus) 6480464 Phenobarbital affects the expression of USP7 mRNA CTD PMID:23091169 Usp7 Rat phlorizin decreases expression ISO Usp7 (Mus musculus) 6480464 Phlorhizin results in decreased expression of USP7 mRNA CTD PMID:22538082 Usp7 Rat picoxystrobin decreases expression ISO USP7 (Homo sapiens) 6480464 picoxystrobin results in decreased expression of USP7 mRNA CTD PMID:33512557 Usp7 Rat pinosylvin increases expression ISO USP7 (Homo sapiens) 6480464 pinosylvin results in increased expression of USP7 mRNA CTD PMID:23333577 Usp7 Rat pyrimidifen decreases expression ISO USP7 (Homo sapiens) 6480464 pyrimidifen results in decreased expression of USP7 mRNA CTD PMID:33512557 Usp7 Rat raloxifene decreases expression ISO Usp7 (Mus musculus) 6480464 Raloxifene Hydrochloride results in decreased expression of USP7 mRNA CTD PMID:33269387 Usp7 Rat resveratrol multiple interactions ISO Usp7 (Mus musculus) 6480464 6-chloro-2 more ... CTD PMID:25665036 Usp7 Rat resveratrol multiple interactions ISO USP7 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of USP7 mRNA CTD PMID:23557933 Usp7 Rat rotenone decreases expression ISO USP7 (Homo sapiens) 6480464 Rotenone results in decreased expression of USP7 mRNA CTD PMID:33512557 Usp7 Rat sirolimus multiple interactions ISO USP7 (Homo sapiens) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Sirolimus inhibits the reaction [[[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein]] and Sirolimus inhibits the reaction [[[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein] CTD PMID:32802178 Usp7 Rat sirtinol multiple interactions ISO Usp7 (Mus musculus) 6480464 sirtinol inhibits the reaction [resveratrol inhibits the reaction [Doxorubicin results in increased expression of USP7 protein]] CTD PMID:25665036 Usp7 Rat sodium arsenite multiple interactions ISO USP7 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein more ... CTD PMID:32802178 Usp7 Rat sunitinib increases expression ISO USP7 (Homo sapiens) 6480464 Sunitinib results in increased expression of USP7 mRNA CTD PMID:31533062 Usp7 Rat testosterone decreases expression ISO USP7 (Homo sapiens) 6480464 Testosterone results in decreased expression of USP7 mRNA CTD PMID:33359661 Usp7 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of USP7 mRNA CTD PMID:25729387 Usp7 Rat topotecan decreases expression EXP 6480464 Topotecan results in decreased expression of USP7 mRNA CTD PMID:25729387 Usp7 Rat trans-pinosylvin increases expression ISO USP7 (Homo sapiens) 6480464 pinosylvin results in increased expression of USP7 mRNA CTD PMID:23333577 Usp7 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of USP7 mRNA CTD PMID:33387578 Usp7 Rat trichostatin A affects expression ISO USP7 (Homo sapiens) 6480464 trichostatin A affects the expression of USP7 mRNA CTD PMID:28542535 Usp7 Rat triptonide increases expression ISO Usp7 (Mus musculus) 6480464 triptonide results in increased expression of USP7 mRNA CTD PMID:33045310 Usp7 Rat troglitazone decreases expression ISO Usp7 (Mus musculus) 6480464 troglitazone results in decreased expression of USP7 mRNA CTD PMID:28973697 Usp7 Rat tungsten decreases expression ISO Usp7 (Mus musculus) 6480464 Tungsten results in decreased expression of USP7 mRNA CTD PMID:30912803 Usp7 Rat valproic acid increases methylation ISO USP7 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of USP7 gene CTD PMID:29154799 Usp7 Rat valproic acid affects expression ISO USP7 (Homo sapiens) 6480464 Valproic Acid affects the expression of USP7 mRNA CTD PMID:25979313 Usp7 Rat valproic acid decreases expression ISO USP7 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of USP7 mRNA CTD PMID:28001369 Usp7 Rat wortmannin multiple interactions ISO USP7 (Homo sapiens) 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde inhibits the reaction [Wortmannin inhibits the reaction [[[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein]] and Wortmannin inhibits the reaction [[[sodium arsenite results in increased abundance of Arsenic] which co-treated with Benzo(a)pyrene] results in increased expression of USP7 protein] CTD PMID:32802178
Imported Annotations - PID (archival)
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 3,3',5,5'-tetrabromobisphenol A (EXP,ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 4-amino-2,6-dinitrotoluene (EXP) 4-hydroxyphenyl retinamide (ISO) 4-nitrophenol (ISO) 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide (ISO) ABT-737 (ISO) aflatoxin B1 (ISO) antirheumatic drug (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) azoxystrobin (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) Bisphenol B (ISO) bisphenol F (ISO) butanal (ISO) cadmium dichloride (EXP) caffeine (ISO) carbon nanotube (ISO) carbonyl sulfide (EXP) chloroprene (EXP) chloroquine (ISO) chlorpyrifos (ISO) cisplatin (ISO) clofibrate (ISO) cocaine (EXP) Cuprizon (ISO) cycloheximide (ISO) cytarabine (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) dibutyl phthalate (ISO) dimethylarsinic acid (ISO) doxorubicin (EXP,ISO) enzyme inhibitor (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fenofibrate (ISO) fenthion (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) fulvestrant (ISO) genistein (EXP) gentamycin (EXP) haloperidol (ISO) hydrogen peroxide (ISO) indometacin (ISO) ivermectin (ISO) menadione (ISO) methidathion (ISO) methylmercury chloride (ISO) microcystin-LR (ISO) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) nefazodone (EXP) oxaliplatin (EXP) paracetamol (EXP) paraquat (ISO) perfluorooctane-1-sulfonic acid (ISO) phenethyl isothiocyanate (EXP) phenobarbital (ISO) phlorizin (ISO) picoxystrobin (ISO) pinosylvin (ISO) pyrimidifen (ISO) raloxifene (ISO) resveratrol (ISO) rotenone (ISO) sirolimus (ISO) sirtinol (ISO) sodium arsenite (ISO) sunitinib (ISO) testosterone (ISO) topotecan (EXP) trans-pinosylvin (ISO) trichloroethene (EXP) trichostatin A (ISO) triptonide (ISO) troglitazone (ISO) tungsten (ISO) valproic acid (ISO) wortmannin (ISO)
Biological Process
DNA alkylation repair (IEA,ISO,ISS) DNA damage response (IEA) DNA repair (IEA) monoubiquitinated protein deubiquitination (IEA,ISO) negative regulation of gene expression via chromosomal CpG island methylation (IEA,ISO,ISS) negative regulation of gluconeogenesis (IEA,ISO,ISS) negative regulation of NF-kappaB transcription factor activity (ISO) negative regulation of proteasomal ubiquitin-dependent protein catabolic process (IEA,ISO) negative regulation of TORC1 signaling (IEA,ISO) positive regulation of apoptotic process (IDA) protein deubiquitination (IDA,IEA,ISO,ISS) protein stabilization (IEA,ISO,ISS) proteolysis (IEA) regulation of circadian rhythm (IEA,ISO,ISS) regulation of DNA-binding transcription factor activity (ISO,ISS) regulation of establishment of protein localization to telomere (IEA,ISO) regulation of protein stability (IBA,IDA,IEA,ISO) regulation of retrograde transport, endosome to Golgi (IEA,ISO) rhythmic process (IEA) symbiont-mediated disruption of host cell PML body (IEA,ISO) transcription elongation-coupled chromatin remodeling (ISO) transcription-coupled nucleotide-excision repair (IEA,ISO,ISS)
Molecular Function
cysteine-type deubiquitinase activity (IBA,IDA,IEA,ISO,ISS) cysteine-type endopeptidase activity (IEA,ISO,ISS) cysteine-type peptidase activity (IEA) deubiquitinase activity (IEA,ISO,ISS) hydrolase activity (IEA) identical protein binding (IPI) K48-linked deubiquitinase activity (IEA,ISO,ISS) p53 binding (IEA,ISO) peptidase activity (IEA) protein binding (ISO)
1.
Molecular cloning of rHAUSP encoding a deubiquitinating enzyme in rat testis.
Baek KH, etal., Oncol Rep. 2006 Jan;15(1):173-7.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Modes of p53 regulation.
Kruse JP and Gu W, Cell. 2009 May 15;137(4):609-22. doi: 10.1016/j.cell.2009.04.050.
5.
HAUSP, a deubiquitinating enzyme for p53, is polyubiquitinated, polyneddylated, and dimerized.
Lee HJ, etal., FEBS Lett. 2005 Aug 29;579(21):4867-72.
6.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
7.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
8.
GOA pipeline
RGD automated data pipeline
9.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
Comprehensive gene review and curation
RGD comprehensive gene curation
Usp7 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 7,335,508 - 7,432,018 (+) NCBI GRCr8 mRatBN7.2 10 6,880,684 - 6,925,355 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 6,828,795 - 6,925,355 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 11,588,325 - 11,631,578 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 11,084,682 - 11,128,048 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 6,735,783 - 6,779,154 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 6,930,462 - 7,019,910 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 6,975,244 - 7,018,930 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 5,752,834 - 5,822,229 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 6,917,612 - 6,963,452 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 6,917,611 - 6,963,451 (+) NCBI Celera 10 5,876,459 - 5,919,649 (+) NCBI Celera Cytogenetic Map 10 q12 NCBI
USP7 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 16 8,892,097 - 8,963,906 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 16 8,892,097 - 8,975,328 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 16 8,985,954 - 9,057,763 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 16 8,893,452 - 8,964,842 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 16 8,894,850 - 8,964,842 NCBI Celera 16 9,152,724 - 9,223,882 (-) NCBI Celera Cytogenetic Map 16 p13.2 NCBI HuRef 16 8,907,081 - 8,945,418 (-) NCBI HuRef CHM1_1 16 8,985,936 - 9,057,340 (-) NCBI CHM1_1 T2T-CHM13v2.0 16 8,924,836 - 8,996,578 (-) NCBI T2T-CHM13v2.0
Usp7 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 16 8,506,586 - 8,574,931 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 16 8,507,459 - 8,610,172 (-) Ensembl GRCm39 Ensembl GRCm38 16 8,688,722 - 8,757,067 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 16 8,689,595 - 8,792,308 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 16 8,688,815 - 8,738,435 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 16 8,606,101 - 8,653,606 (-) NCBI MGSCv36 mm8 Celera 16 9,334,440 - 9,362,384 (-) NCBI Celera Cytogenetic Map 16 A1 NCBI cM Map 16 4.28 NCBI
Usp7 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955442 9,315,225 - 9,356,393 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955442 9,316,022 - 9,355,751 (+) NCBI ChiLan1.0 ChiLan1.0
USP7 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 18 9,431,901 - 9,501,001 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 16 13,210,502 - 13,278,888 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 16 7,825,332 - 7,895,095 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 16 9,065,366 - 9,106,406 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 16 9,065,858 - 9,106,146 (-) Ensembl panpan1.1 panPan2
USP7 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 6 33,277,328 - 33,315,601 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 6 33,277,444 - 33,314,491 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 6 34,641,327 - 34,706,509 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 6 33,449,047 - 33,514,314 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 6 33,448,218 - 33,514,312 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 6 33,251,796 - 33,316,926 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 6 33,121,375 - 33,186,820 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 6 33,570,486 - 33,608,545 (+) NCBI UU_Cfam_GSD_1.0
Usp7 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 109,848,236 - 109,882,862 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936530 7,694,379 - 7,724,684 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936530 7,693,681 - 7,724,215 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
USP7 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 33,775,829 - 33,810,465 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 33,754,357 - 33,810,480 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 34,686,115 - 34,742,973 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
USP7 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 5 8,470,137 - 8,540,736 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 5 8,469,230 - 8,540,770 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666068 21,677,314 - 21,749,766 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Usp7
.
Predicted Target Of
Count of predictions: 34 Count of miRNA genes: 32 Interacting mature miRNAs: 34 Transcripts: ENSRNOT00000046232 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2313095 Bss62 Bone structure and strength QTL 62 1.5 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 5387014 50387014 Rat 631660 Hcar1 Hepatocarcinoma resistance QTL 1 3.4 0.0001 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 10 6154182 15990232 Rat 1576304 Schws7 Schwannoma susceptibility QTL 7 0.0115 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 4765527 19816042 Rat 8662860 Vetf10 Vascular elastic tissue fragility QTL 10 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 10 6154182 73453136 Rat 2313066 Bss63 Bone structure and strength QTL 63 1.4 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 10 5387014 50387014 Rat 7411611 Foco17 Food consumption QTL 17 18.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 1 42315980 Rat 631554 Bp133 Blood pressure QTL 133 0.005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 743364 63851208 Rat 2313064 Bmd71 Bone mineral density QTL 71 0.9 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 10 5387014 50387014 Rat 70223 Bp57 Blood pressure QTL 57 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 1 80676123 Rat 634329 Pia15 Pristane induced arthritis QTL 15 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 1 24158324 Rat 1578761 Stresp21 Stress response QTL 21 3.3 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 10 6375746 51375746 Rat 2293680 Bss40 Bone structure and strength QTL 40 5.66 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 10 1 35225947 Rat 7387235 Uae41 Urinary albumin excretion QTL 41 5.26 0.1874 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 10 1 29497586 Rat 2313104 Bss61 Bone structure and strength QTL 61 0.9 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 10 5387014 50387014 Rat 2298544 Neuinf9 Neuroinflammation QTL 9 4.6 nervous system integrity trait (VT:0010566) spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126) 10 5801990 62146030 Rat 61427 Cia16 Collagen induced arthritis QTL 16 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 6357896 96121100 Rat 10401803 Kidm50 Kidney mass QTL 50 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 10 418344 45418344 Rat 737820 Alc9 Alcohol consumption QTL 9 2.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 10 5144027 19233348 Rat 2313081 Bss64 Bone structure and strength QTL 64 1.3 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 10 5387014 50387014 Rat 631828 Alc5 Alcohol consumption QTL 5 2.4 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 10 5144027 17245662 Rat 634327 Hc4 Hypercalciuria QTL 4 2.4 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 10 1 38328221 Rat
RH143229
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 10 7,428,098 - 7,428,295 (+) Marker Load Pipeline mRatBN7.2 10 6,921,435 - 6,921,632 (+) MAPPER mRatBN7.2 Rnor_6.0 10 7,015,988 - 7,016,184 NCBI Rnor6.0 Rnor_5.0 10 5,818,307 - 5,818,503 UniSTS Rnor5.0 RGSC_v3.4 10 6,960,708 - 6,960,904 UniSTS RGSC3.4 Celera 10 5,916,898 - 5,917,094 UniSTS RH 3.4 Map 10 67.21 UniSTS Cytogenetic Map 10 q12 UniSTS
RH140275
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 10 7,430,391 - 7,430,857 (+) Marker Load Pipeline mRatBN7.2 10 6,923,728 - 6,924,194 (+) MAPPER mRatBN7.2 Rnor_6.0 10 7,018,281 - 7,018,746 NCBI Rnor6.0 Rnor_5.0 10 5,820,600 - 5,821,065 UniSTS Rnor5.0 RGSC_v3.4 10 6,963,001 - 6,963,466 UniSTS RGSC3.4 Celera 10 5,919,198 - 5,919,663 UniSTS Cytogenetic Map 10 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000046232 ⟹ ENSRNOP00000041134
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,896,691 - 6,925,355 (+) Ensembl Rnor_6.0 Ensembl 10 6,975,244 - 7,018,930 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000094143 ⟹ ENSRNOP00000093874
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,892,557 - 6,925,355 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000095866 ⟹ ENSRNOP00000081458
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,895,653 - 6,925,355 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000100242 ⟹ ENSRNOP00000096267
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,880,020 - 6,925,355 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000112945 ⟹ ENSRNOP00000088505
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,894,589 - 6,925,355 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000117646 ⟹ ENSRNOP00000083535
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 6,828,795 - 6,925,355 (+) Ensembl
RefSeq Acc Id:
NM_001024790 ⟹ NP_001019961
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,387,353 - 7,432,018 (+) NCBI mRatBN7.2 10 6,880,684 - 6,925,355 (+) NCBI Rnor_6.0 10 6,975,289 - 7,018,732 (+) NCBI Rnor_5.0 10 5,752,834 - 5,822,229 (+) NCBI RGSC_v3.4 10 6,917,612 - 6,963,452 (+) RGD Celera 10 5,876,459 - 5,919,649 (+) RGD
Sequence:
ATGAACCACCAACAGCAGCAGCAGCAGCAGCAGAAAGCGGGCGAGCAGCAGCTGAGCGAGCCCGAGGACATGGAGATGGAAGCTGGAGATACAGATGACCCACCAAGAATTACTCAGAACCCCGTCAT
hide sequence
RefSeq Acc Id:
XM_006245757 ⟹ XP_006245819
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,396,481 - 7,432,018 (+) NCBI mRatBN7.2 10 6,891,946 - 6,925,033 (+) NCBI Rnor_6.0 10 6,986,082 - 7,019,910 (+) NCBI Rnor_5.0 10 5,752,834 - 5,822,229 (+) NCBI
Sequence:
TACATATATACAGCTGAATCAGGGAGGCAGGTTATACAGCTGAATGCCAAGGAAGCTGTCTTAGCTAATCTTGCTGGGGAACAGACCTTGGGCTGTAAACCCGATGGATATTTGGGGCATTTCTGCAT
hide sequence
RefSeq Acc Id:
XM_063269283 ⟹ XP_063125353
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,335,508 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269284 ⟹ XP_063125354
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,367,617 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269285 ⟹ XP_063125355
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,367,599 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269286 ⟹ XP_063125356
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,335,508 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269287 ⟹ XP_063125357
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,386,737 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269288 ⟹ XP_063125358
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,396,481 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269289 ⟹ XP_063125359
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,404,604 - 7,432,018 (+) NCBI
RefSeq Acc Id:
XM_063269290 ⟹ XP_063125360
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 7,415,812 - 7,432,018 (+) NCBI
RefSeq Acc Id:
NP_001019961 ⟸ NM_001024790
- UniProtKB:
Q4VSI4 (UniProtKB/Swiss-Prot), A0A8I6AP58 (UniProtKB/TrEMBL)
- Sequence:
MNHQQQQQQQQKAGEQQLSEPEDMEMEAGDTDDPPRITQNPVINGNVALSDGHSNAEEDMEDDTSWRSEATFQFTVERFSRLSESVLSPPCFVRNLPWKIMVMPRFYPDRPHQKSVGFFLQCNAESDS
hide sequence
RefSeq Acc Id:
XP_006245819 ⟸ XM_006245757
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6AKU3 (UniProtKB/TrEMBL), A0A8I5ZSA1 (UniProtKB/TrEMBL)
- Sequence:
MAGNYRLGQEAGDTDDPPRITQNPVINGNVALSDGHSNAEEDMEDDTSWRSEATFQFTVERFSRLSESVLSPPCFVRNLPWKIMVMPRFYPDRPHQKSVGFFLQCNAESDSTSWSCHAQAVLKIINYR
hide sequence
Ensembl Acc Id:
ENSRNOP00000041134 ⟸ ENSRNOT00000046232
Ensembl Acc Id:
ENSRNOP00000083535 ⟸ ENSRNOT00000117646
Ensembl Acc Id:
ENSRNOP00000088505 ⟸ ENSRNOT00000112945
Ensembl Acc Id:
ENSRNOP00000081458 ⟸ ENSRNOT00000095866
Ensembl Acc Id:
ENSRNOP00000096267 ⟸ ENSRNOT00000100242
Ensembl Acc Id:
ENSRNOP00000093874 ⟸ ENSRNOT00000094143
RefSeq Acc Id:
XP_063125353 ⟸ XM_063269283
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZSA1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125356 ⟸ XM_063269286
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZZJ8 (UniProtKB/TrEMBL), A0A8I5ZSA1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125355 ⟸ XM_063269285
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZZJ8 (UniProtKB/TrEMBL), A0A8I5ZSA1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125354 ⟸ XM_063269284
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZSA1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125357 ⟸ XM_063269287
- Peptide Label:
isoform X3
- UniProtKB:
Q4VSI4 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_063125358 ⟸ XM_063269288
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I5ZSA1 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125359 ⟸ XM_063269289
- Peptide Label:
isoform X6
- UniProtKB:
A0A8I6A6B9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063125360 ⟸ XM_063269290
- Peptide Label:
isoform X7
RGD ID: 13696950 Promoter ID: EPDNEW_R7475 Type: single initiation site Name: Usp7_1 Description: ubiquitin specific peptidase 7 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 6,975,333 - 6,975,393 EPDNEW
BioCyc Gene G2FUF-26099 BioCyc
Ensembl Genes ENSRNOG00000025496 Ensembl, ENTREZGENE
Ensembl Transcript ENSRNOT00000094143 ENTREZGENE
ENSRNOT00000100242 ENTREZGENE
ENSRNOT00000117646 ENTREZGENE
Gene3D-CATH Apoptosis, Tumor Necrosis Factor Receptor Associated Protein 2, Chain A UniProtKB/Swiss-Prot
Cysteine proteinases UniProtKB/Swiss-Prot
Phosphatidylinositol 3-kinase Catalytic Subunit, Chain A, domain 1 UniProtKB/Swiss-Prot
InterPro MATH/TRAF_dom UniProtKB/Swiss-Prot
Papain-like_cys_pep_sf UniProtKB/Swiss-Prot
Peptidase_C19 UniProtKB/Swiss-Prot
Peptidase_C19_UCH UniProtKB/Swiss-Prot
TRAF-like UniProtKB/Swiss-Prot
USP7_ICP0-binding_dom UniProtKB/Swiss-Prot
USP_C UniProtKB/Swiss-Prot
USP_CS UniProtKB/Swiss-Prot
USP_dom UniProtKB/Swiss-Prot
KEGG Report rno:360471 UniProtKB/Swiss-Prot
NCBI Gene 360471 ENTREZGENE
PANTHER UBIQUITIN CARBOXYL-TERMINAL HYDROLASE UniProtKB/Swiss-Prot
UBIQUITIN CARBOXYL-TERMINAL HYDROLASE 7 UniProtKB/Swiss-Prot
Pfam MATH_2 UniProtKB/Swiss-Prot
UCH UniProtKB/Swiss-Prot
USP7_C2 UniProtKB/Swiss-Prot
USP7_ICP0_bdg UniProtKB/Swiss-Prot
PhenoGen Usp7 PhenoGen
PROSITE MATH UniProtKB/Swiss-Prot
USP_1 UniProtKB/Swiss-Prot
USP_2 UniProtKB/Swiss-Prot
USP_3 UniProtKB/Swiss-Prot
RatGTEx ENSRNOG00000025496 RatGTEx
SMART MATH UniProtKB/Swiss-Prot
Superfamily-SCOP SSF54001 UniProtKB/Swiss-Prot
TRAF domain-like UniProtKB/Swiss-Prot
UniProt A0A8I5ZSA1 ENTREZGENE, UniProtKB/TrEMBL
A0A8I5ZZJ8 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6A6B9 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6AKU3 ENTREZGENE, UniProtKB/TrEMBL
A0A8I6AP58 ENTREZGENE, UniProtKB/TrEMBL
A6K4L6_RAT UniProtKB/TrEMBL
F1LM09_RAT UniProtKB/TrEMBL
Q4VSI4 ENTREZGENE, UniProtKB/Swiss-Prot
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-08-18
Usp7
ubiquitin specific peptidase 7
Usp7
ubiquitin specific peptidase 7 (herpes virus-associated)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-10-23
Usp7
ubiquitin specific peptidase 7 (herpes virus-associated)
Usp7
ubiquitin specific peptidase 7
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-04
Usp7
ubiquitin specific peptidase 7
Usp7
ubiquitin specific protease 7 (herpes virus-associated)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Usp7
ubiquitin specific protease 7 (herpes virus-associated)
Usp7_predicted
ubiquitin specific protease 7 (herpes virus-associated) (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Usp7_predicted
ubiquitin specific protease 7 (herpes virus-associated) (predicted)
Symbol and Name status set to approved
70820 APPROVED
